BIOLOGÍA CARMEN EUGENIA PIÑA LÓPEZ Directora Nacional. FEDRA LORENA ORTIZ Acreditadora BOGOTA 2013

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGI

17 downloads 143 Views 6MB Size

Story Transcript

UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA – UNAD ESCUELA DE CIENCIAS BASICAS, TECNOLOGÍA E INGENIERIA CONTENIDO DIDÁCTICO DEL CURSO: 210101 – BIOLOGIA

20101 - BIOLOGÍA CARMEN EUGENIA PIÑA LÓPEZ Directora Nacional FEDRA LORENA ORTIZ Acreditadora

BOGOTA 2013

__________________ 1

Ed.D. Tecnología Instruccional y Educación a Distancia,MSc. Ciencias Biológicas; MSc. Docencia Universitaria; Especialista en Nutrición Animal Sostenible; Especialista en Informática y Multimedia.

2

Aspectos de Propiedad Intelectual y Versionamiento El presente módulo fue diseñado en el año 2005 por Carmen Eugenia Piña López,Ed.D. Tecnología Instruccional y Educación a Distancia,MSc. Ciencias Biológicas; MSc. Docencia Universitaria; Especialista en Nutrición Animal Sostenible; Especialista en Informática y Multimedia. Docente de la UNAD desde 1986 El presente módulo ha tenido cinco actualizaciones durante los cuales se han realizado mejoramientos académico-pedagógicos en los siguientes aspectos:

1. Mejoramiento en áreas temáticas Incorporación de contenidos de biotecnología, profundización en área de ecología y ampliación de vínculos hipertextuales para actualización disciplinar según el estado del arte y experiencias didácticas con objetos virtuales.

2. Mejoramiento didáctico Adecuación de unidades para manejo mediante el sistema de créditos con el tiempo regulado para 3 créditos académicos. Realización de curso hipermedia tanto para el contenido teórico como para el desarrollo de laboratorios con estrategias de aprendizaje por fases de reconocimiento, profundización y transferencia. El material explicita la estrategia pedagógica mediante un protocolo académico y una guía de actividades en concordancia con los parámetros institucionales y el Proyecto Académico Pedagógico. Incorporación de Objetos de Aprendizaje OA, realizados por la autora y por los tutores de la red de Biología

3. Mejoramiento académico-pedagógico La organización sistemática de actividades de aprendizaje, por fases de reconocimiento, profundización y transferencia, está orientada a propiciar la investigación formativa y la resolución de problemas del entorno del estudiante, aspecto que propicia la articulación con proyectos interdisciplinarios, para generar campos de desarrollo académico en las regiones, como estrategia para fortalecer la comunidad académica.

3

4. Avance cognitivo-pedagógico mediante el aprovechamiento de las TIC Los estudiantes encuentran en el manejo hipertextual del curso virtual de biología, oportunidades para establecer una relación personalizada con el conocimiento, de acuerdo con su propio tipo cognitivo, su ritmo de autoaprendizaje, el desarrollo de competencias de autocontrol y autorregulación del estudio, el aprovechamiento de objetos virtuales de aprendizaje que aportan una riqueza explicativa difícil de conseguir en tutorías presenciales, opciones selectas de navegación por fuentes de consulta que renuevan permanentemente el estado del arte en las temáticas del curso, y la orientación para un futuro desempeño profesional sobre los vínculos posibles y más pertinentes con la comunidad académica nacional e internacional en la disciplina.

4

CONTENIDO Página 10 11 12 13 13

Introducción Justificación Contexto Esquema Organización Epistemológica Avances Internacionales Unidad 1. Los Seres vivos Introducción Capítulo 1. Origen y características de los seres vivos Lección 1. El comienzo de la vida Lección2. Experimento de Miller Lección 3. Evolución celular Lección 4. Estructura y función de los seres vivos Lección 5. Descripción características Capítulo 2. Niveles de organización de la vida

17 21 23 25 31 33

Lección 6. La célula – Historia, Teoría celular, Microscopía

38

Lección 7. Estructura y función de células procariotas Lección 8.Estructura y función de células eucariotas Lección 9. Procesos Celulares Lección 10.División celular-Mitosis y Meiosis Capítulo 3. Organismos Pluricelulares y Unicelulares Lección 11. Tejidos animales Lección 12. Tejidos vegetales

42 57 74 79 90 95

Lección 13. Estructura y Funciones Animales Lección 14. Estructura y Funciones Vegetales Lección 15. Los Microorganismos

98 133 148

Unidad 2. Diversidad de la vida Capítulo 4. Sistemática Lección 16. Introducción Lección 17. Taxonomía y sistemas de clasificación Lección 18. Categorías supraespecíficas y claves Lección 19. Concepto de especie Lección 20. Nomenclatura

181 182 183 186 188

Capítulo 5. La información genética Lección 21. Información Genética Cromosomas , genotipo,

205

5

fenotipo Lección 22. Genes y alelos Lección 23. Leyes de Mendel Lección 24. Aplicación de las leyes de Mendel Lección 25.Síntesis de proteínas Capítulo 6. Biotecnología Lección 26.Conocimientos básicos Lección 27.Los pasos de la Ingeniería Genética Lección 28. Herramientas básicas de la ingeniería genética Lección 29. Transferencia de genes Lección 30.Desafíos tecnológicos Unidad 3. Interacciones de la vida Capítulo 7. Ecología Lección 31. Conceptos Básicos Lección 32. Los ecosistemas como unidad de estudio

206 210 212 217 225 227 229 234 237

239 241

Lección 33. Tipos de ecosistemas 246 Lección 34. Relaciones alimentarias, redes Tróficas 247 Lección 35. Ciclos de la materia y flujo de energía 247 Capítulo 8. Productividad Ecológica Lección 36. Productividad de los ecosistemas. Interacciones entre los factores bióticos y abióticos 249 Lección 37.Relaciones entre individuos 252 Lección 38. Aplicaciones para la conservación de la biodiversidad 257 Lección 39. Pensamiento sistémico y desarrollo sustentable Lección 40. Pensamiento agroecológico262 Capítulo 9. Evolución 41. Conceptos Básico 42. Teoría Lamarkiana de la evolución 43. Teoría Darwinista de la Evolución 44. Teoría Neodarwinista de la evolución290 45. Evolución del hombre291

259

288 288 288

6

INDICE DE FIGURAS Figura 1 Esquema epistemológico para curso virtual de biología Figura 2 Claves de la Unidad 1 Los Seres Vivos Figura 3 Origen de la vida Figura 4 Experimento de Miller Figura 5 Evolución Celular Figura 6 Etapas evolutivas de la célula procariota primitiva Figura 7 Proceso evolutivo planteado por la teoría endosimbiótica Figura 8 Reproducción Figura 9 Adaptaciones Figura 10 El Microscopio y sus partes Figura 11 Objetivos Figura 12 Ocular Figura 13 Platina Figura 14 Condensador y Diafragma Figura 15 Tornillos Macrométrico y Micrométrico Figura 16 Poder de Aumento Figura 17 Poder de Penetración Figura 18 Poder de Resolución Figura 19 Objetivo donde se visualiza el aumento y la apertura numérica Figura 20Distancia Focal Figura 21Distancia Focal Figura 22 Formación de la imagen invertida Figura 23 Refracción de la Luz Figura 24Corrección de la refracción de la Luz Figura 25 Campo de visión Figura 26montaje de papel milimetrado Figura 27Papel milimetrado con aumento de 4X Figura 28 Comparición Célula Procarita y Célula Eucariota Figura 29 Esquema de una célula Procariota Figura 30Célula Eucariota Animal Figura 31Célula Eucariota Vegetal Figura 32 Membrana Plasmática Figura 33 Eritocitos Figura 34 El Núcleo Figura 35 El Cromosoma Figura 36 El Retículo Endoplasmático Figura 37 El Ribososma Figura 38 La Mitocondria Figura 39Aparato de Golgi Figura 40Centriolos Figura 41Cloroplasto

13 20 21 24 24 26 26 28 35 40 41 41 42 42 43 44 45 45 46 46 47 48 48 49 50 50 51 54 55 56 58 59 63 64 65 66 67 68 69 71 71

7

Figura 42Ilustraciones comparativas de interfase Figura 43Ilustraciones comparativas de profase Figura 44Ilustraciones comparativas de metafase Figura 45Ilustraciones comparativas de anafase Figura 46Ilustraciones comparativas de telofase Figura 47Célula animal en Interfase en meiosis I Figura 48Profase I a Figura 49Profase I b Figura 50 Esquema con representación de cromosomas con alelos para un carácter Figura 51Esquema con representación de entrecruzamiento de cromosomas no hermanos Figura 52Esquema con representación de cromosomas no hermanos en sinapsis Figura 53Profase I c Formación de tétradas en la profase l Figura 54 Metafase I Figura 55Anafase I Figura 56 Telofase I Figura 57Citoscinesis Figura 58 Profase II Figura 59Metafase II Figura 60Anafase II Figura 61Telofase II Figura 62Citocinesis II Figura 63Tejido Epitelial de Revestimiento Figura 64Tejido Epitelial Glandular Figura 65Tejido Conjuntivo Figura 66Tejido cartilaginoso Figura 67Tejido Nervioso Figura 68Tejido Muscular Liso Figura 69 Tejido Muscular Estriado Figura 70 Tejido muscular Cardiaco Figura 71Tejido meristemático en mitosis de cebolla Figura 72Tejido epidermal de bulbo de cebolla Figura 73Tejido epidermal con estomas Figura 74Tejido epidermal y parenquimático en hoja de Elodea Figura 75Tejido parenquimático en corte de papa Figura 76Xilema Figura 77 Colénquima Figura 78 Representación de la boca Figura 79 Representación del sistema digestivo

80 81 82 83 83 84 85 85 86 86 87 87 87 88 88 87 88 88 89 89 89 90 91 92 92 93 94 94 94 95 96 96 97 97 98 98 100 100

8

Figura 80 Representación de los esfínteres cardias y piloro Figura 81 Representación del sistema circulatorio Figura 82 Representación del corazón Figura 83 Representación de los principales vasos del corazón Figura 84 Representación del funcionamiento del corazón Figura 85 Aparato Respiratorio Figura 86 Representación del alvéolo pulmonar rodeado de capilares Figura 87 Representación del intercambio de gases en el alvéolo pulmonar Figura 88 Representación del sistema renal Figura 89 La Nefrona Figura 90 Aparato Reproductor masculino Figura 91 Aparato reproductor femenino Figura 92 Sistema Nervioso Central Figura 93 Encéfalo Figura 94 La Neurona Figura 95 Generalidades del sitema sensoriales Figura 96 Organo de la visión Figura 97 Órganos anexos de la visión Figura 98 Organo de la audición Figura 99 Glándulas endocrinas Figura 100 Partes de la raíz Figura 101 Maduración de la raíz Figura 102 Raices adventicias Figura 103 Raiz napiforme Figura 104 Estructura del tallo Figura 105 Estructura de la hoja Figura 106 Hojas según su forma Figura 107 La flor Figura 108 Microfotografía de Adenovirus Figura 109 Representación esquemática de un virus bacteriófago Figura 110 Representación esquemática de bacteriófago infectando una bacteria Figura 111 Esquema explicativo poder infectivo de los Priones Figura 112 Representación esquemática de una bacteria Figura 113 Representación reproducción de una bacteria Figura 114 Caracteristica del paramecio Figura 115 Entamoeba histolítica Figura 116 Paramecium Figura 117 Tripanosomas en sangre Figura 118 Plasmodio falciparum Figura 119 Alga Closterium

100 102 104 105 108 112 113 114 114 115 116 118 120 120 122 124 126 127 128 133 135 136 136 137 139 139 140 142 148 149 149 155 163 167 173 173 174 174 174 175

9

Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura Figura

120 Alga Spirogyra 121 hongo del tomate 122 Sistemas de clasificación por Robert Whittaker 123 Sisitema de clasificación de los seres vivos De Carl Woese 124 Categorías supraespecíficas 125 Determinación de grupo monofilético por ancestro común 126 Cladograma mostrando relaciones evolutivas 127 Divergencia de antecesor común 128 Estructura del ADN 129 replicación del ADN 130 Estrutura del gen 131 Primera ley de Mendel 132 Segunda ley de Mendel 133 Retrocruzamiento 134 Tercera Ley Mendel 135 Segunda generación filial 136 Segunda generación filial 137 Síntesis de proteína 138 Síntesis de proteína Etapa 2 y 3 139 Síntesis de proteína Etapa Terminación 150 Esquema de los ribosomas en la sístesis de proteína 151 Flujograma Ecologia 152 Flujograma Ecosistema 153 Ejemplo de cadena trófica 154 Red alimenticia 155 Pirámide de energía de una cadena trófica acuática 156 Ciclo energético del ecosistema 157 Niveles de organización en la naturaleza

175 176 182 184 187 193 195 196 205 206 208 215 216 217 218 219 220 222 223 223 224 241 242 248 250 251 252 262

10

INTRODUCCIÓN

Biología busca unir la calidad académica de los contenidos disciplinares con posibilidades de interacción del estudiante con las fuentes hipertextuales e hipermediales organizadas para un uso amigable y de óptimo refuerzo didáctico, que motive una navegación entusiasta en el proceso de construcción autónoma de los conceptos disciplinares y un proceso de interacción con las herramientas de comunicación del curso, tales como foro, chat, correo electrónico y otros. El curso está orientado a la autogestión estudiantil de los conocimientos teóricos necesarios para la comprensión de la estructura y funcionamiento de los organismos vivos en su biodiversidad como resultado evolutivo. Este conocimiento se aborda como un insumo de transferible a futuras situaciones de desempeño profesional y de comportamiento bioético, como un bagaje de trabajo inter y transdisciplinar (orientado con procesos de investigación formativa) totalmente necesario para seres que deben actuar con inteligencia en su medio ambiente, o sea en su base material y cultural de supervivencia como especie. En otros aspectos, se puede decir que la apropiación teórica del conocimiento en biología, se guiará por el cuerpo disciplinar que maneja la comunidad académica internacional (ver estado del arte), identificando, seleccionando y organizando de manera pedagógica unos contenidos básicos fundamentales, totalmente necesarios para aprehender los conocimientos estructurales de la disciplina, de los cuales se deriva el resto de conocimientos del área biológica y sus aplicaciones. El componente práctico se desarrollará mediante laboratorios previamente apoyados en vídeos didácticos introductorios y se complementará con observaciones de campo. Para efectos de precisión de conceptos el estudioso puede apoyarse en el glosario, espacio que además de definiciones importantes, agrupa respuestas a preguntas enviadas por los estudiosos en busca de una mayor aclaración. El objetivo es trabajar en red colaborativa de tutores y estudiosos para enriquecer este banco de definiciones y de respuestas a preguntas frecuentes. ¡Bienvenidos! Carmen Eugenia Piña López (Autora)

11

Justificación Todo profesional del campo de las ciencias naturales y con disciplinas que requieren la competencia de pensamiento sistémico o complejo, como es el caso de profesionales relacionados con los programas que oferta la UNAD en: Ingeniería de Alimentos, Ciencias Agrarias, Psicología o Regencia en Farmacia, no podrá desarrollar innovaciones y mejoramientos en su campo profesional si no comprende los principios básicos del funcionamiento de la vida al interior de los organismos, y en el desarrollo de sus relaciones con el medio ambiente y con otros seres vivos macro o microscópicos. Igualmente, sería imposible desarrollar procesos de investigación en las anteriores áreas, sin comprender las leyes biológicas, para plantear hipótesis lógicas y científicamente probables. Muchos de los problemas a los que da solución la Biología tienen una innegable repercusión en el mejoramiento de las condiciones de vida: producción de alimentos, salud, producción animal, agricultura entre otros. El curso es de tipo metodológico ya que la apropiación dinámica del conocimiento en biología, se guiará por el cuerpo disciplinar que maneja la comunidad académica internacional, identificando, seleccionando y organizando de manera pedagógica unos contenidos básicos fundamentales, totalmente necesarios para aprehender los conocimientos estructurales de la disciplina, de los cuales se deriva el resto de conocimientos del área biológica y sus aplicaciones. El componente práctico se desarrollará mediante laboratorios previamente apoyados en vídeos didácticos introductorios y se complementará con observaciones de campo En el estudio de la biología hay ciertos procesos como la meiosis, la síntesis y transferencia de componentes a nivel genético, el proceso de replicación del ADN, el funcionamiento de sistemas orgánicos, etc., que normalmente presentan cierta dificultad para su comprensión por parte del estudiante. El presente curso aporta soluciones didácticas mediante presentaciones hipermedia, que facilitan la comprensión y la resignificación de esta clase de procesos para una integración cognitiva de mayor calidad. La estrategia pedagógica del curso hará énfasis en el desarrollo de competencias básicas, complejas, y transversales, en operaciones metacognitivas, en las actualizaciones, transformaciones, modificaciones o desplazamiento de los conocimientos previos a través del desarrollo de actividades situaciones y actuaciones deaprendizaje que involucran lasfases de reconocimiento, (conocimientos y experiencias previas), profundización (manejo de conceptos y teorías) y transferencia (aplicación del conocimiento a la solución de problemas reales) planificadas en la guía de actividades, además del desarrollo de ciertas

12

habilidades de desempeño profesional importantes para la práctica profesional, incluyendo capacidades investigativas. El desarrollo de las actividades serán evaluadas en forma cualitativa (autoevaluación y coevaluación) y en forma cuantitativa (heteroevaluación sumativa). Este desarrollo permitirá en el estudiante un desarrollo secuencial y coherente en la construcción de esquemas conceptuales como aplicación de la epistemología de la biología y que además aporte unabase suficiente de conocimiento para la comprensión eficiente y efectiva de las disciplinas correlacionadas en el programa académico

Contexto Teórico La biología es una disciplina de las ciencias naturales que permite la comprensión de la manifestación de la vida y su evolución a través de las diferentes especies, hasta generar relaciones interespecíficas de sinergia o de depredación, que en el caso de la sociedad humana derivan contemporáneamente en sistemas de explotación o de aprovechamiento racional de los recursos de biodiversidad según se tenga un criterio simplemente utilitarista o un criterio bioético respectivamente. Los nexos entre la ciencia natural de la biología y el campo disciplinar general de las ciencias biológicas, surgen a partir de la construcción de los conceptos y taxonomías básicas de los seres vivos, las cuales se retoman de manera especializada en campos disciplinares de profundización. Por ejemplo, la genética, la cual a su vez se profundiza después mediante líneas especializadas de genética microbiana, genética humana, genética animal, genética vegetal, etc. El cuerpo de conocimiento disciplinar en el curso de biología tiene una organización epistemológica específica que se sintetiza en la grafica “Esquema epistemológico para curso virtual de biología” la cual permite visualizar una lógica pedagógica para la secuenciación de construcciones conceptuales en el proceso de aprendizaje autónomo, interrelacionando los aspectos de estructura y función, a nivel organísmico, celular, de sistemas y de ecosistemas.

13

Organización Epistemológica

Figura 1: Esquema epistemológico para curso virtual de biología Fuente Carmen Eugenia Piña L

El cuerpo de conocimiento disciplinar en el curso de biología tiene una organización epistemológica específica que se sintetiza en la Figura 2 Avances Internacionales en los contenidos disciplinares de Biología Los avances internacionales se dan en dos aspectos: a) Disciplinares: Avances en el conocimiento del genoma y de las tecnologías de transmisión de información genética (biotecnologías), los cuales permiten mejorar la calidad de los contenidos de los hipertextos que se entregan al estudiante. Avances en el aporte de técnicas biológicas de diagnóstico ambiental, por ejemplo, mediante el análisis de la composición atmosférica primigenia de la tierra,

14

gracias al apoyo de instrumentos más sofisticados (incluyendo sensores remotos y extracción de muestras de capas submarinas profundas o de capas profundas de los polos), con lo cual se puede precisar la explicación teórica sobre el origen o el comienzo de la vida en la tierra, en el currículo de biología que se maneja en el curso virtual. Avances en la comprensión del comportamiento animal, desde el aporte de varias disciplinas (neurobiología, psicología animal, morfofisiología animal, etc), con lo cual se clarifican aspectos del estudio evolutivo y de las interrelaciones ecosistémicas. Avances en la investigación sobre células madre: http://www.euroresidentes.com/Blogs/avances_tecnologicos/2004/06/investigacincon-clulas-madre-para.htm Investigación de células madre aplicadas al transplante de órganos http://www.bionetonline.org/castellano/Content/sc_cont1.htm Conceptos básicos sobre células madre http://www.healthfinder.gov/espanol/Ultimas noticias en temas de salud http://stemcells.nih.gov/info/basics/ Introducción a diversos aspectos de las células madre y su aplicación a la investigación b) Didáctica infovirtual de la biología: Actualmente hay disponibles en internet objetos virtuales de aprendizaje interactivo e hipermedia con animaciones, todos los cuales permiten mejorar la calidad pedagógica de los materiales accesibles desde el aula virtual de biología en el curso a mi cargo. 2.- Incorporación curricular del estado de arte El estado del arte se rastrea por ejemplo en los journals especializados de las diversas temáticas disciplinares de la biología, pero en general, el avance fundamental nace de la biología molecular en el estudio genético y de las proteínas. Esta información actualizada se vierte con la dosificación pedagógica apropiada en el curso virtual de biología. 3.- Criterios de calidad del curso El curso de biología se desarrolla con aplicación de un protocolo académico y de una guía académica que garantizan el cumplimiento de los requisitos de calidad

15

planteados en el decreto 2566 sobre condiciones para acreditación de los programas, incluyendo por ejemplo el caso específico de los créditos académicos como parámetro para la, gestión de tiempos de aprendizaje independiente y con acompañamiento docente, más la optimización disciplinar mediante la actualización de los contenidos y la interacción con redes de comunidades académicas especializadas en la disciplina. 4.- Aplicación de las TIC en el curso El empleo de las TIC se evidencia en el uso de herramientas de aula virtual, para comunicación o interacción dialógica, estudio, cognición y evaluación. El curso de biología está incorporando estos avances de manera adaptada al modelo pedagógico institucional. El campus virtual incluirá además la construcción y fortalecimiento de la red académica de docentes de biología a nivel de todos los CEAD y la interacción con académicos internacionales y nacionales del campo de las ciencias biológicas. 5. Comunidades de aprendizaje autónomo: El aprendizaje virtual incluye y facilita el trabajo colaborativo de grupos de estudiantes a quienes se les pueden asignar en procesos participativos de decisión, tareas contextualizadas para el abordaje de problemas teórico-prácticos de la biología, conectados con realidades ambientales del entorno del estudiante. 6. Referencias internacionales: Direcciones de cursos de biología por parte de universidades internacionalmente acreditadas por la excelencia de sus comunidades académicas en biología, lo cual se transparenta en la calidad de sus materiales hipertextuales y en la organización de sus líneas de investigación. Links a Journals http://www.wmaker.net/tendencias/index.php Revista electrónica de actualización permanente, indexada, de la Universidad Complutense de Madrid, en esta dirección se puede suscribir gratuitamente a la revista. Ecosistemas Revista científica y técnica de ecología y medio ambiente Encuentros en la Biología: Revista científica Edición para Internet de la revista Encuentros en la Biología, editada en la Facultad de Ciencias de la Universidad de Málaga ISSN 1134-8496

16

Sociedad Española de Etología: Difunde los conocimientos etológicos a través de publicaciones, congresos, charlas, y docencia de la Etología en los diversos planes de estudio. Revista Colombiana de Psicologíahttp://www.revistas.unal.edu.co/index.php/psicologia Biotecnologìa Agraria: http://oa.upm.es/8852/1/Olmedo_227.pdf Aplicaciòn de la Biotecnología a la Medicina http://sanic.org/solucionesverdes/index.php?option=com_content&view=article&id= 91:biotecnologia-medicina&catid=3:flash-informativo&Itemid=18 Actualidad Psicológica http://www.angelfire.com/pe/actualidadpsi/ Revista Psicologìa .com http://www.psiquiatria.com/revistas/index.php/psicologiacom/ Revista Farmacia Hospitalariahttp://www.sefh.es/sefhpublicaciones/revista.php Ars Pharmaceutica revista científica de carácter multidisciplinar, en el ámbito de las ciencias farmacéuticashttp://farmacia.ugr.es/ars/ars_web/# Farmacia Hospitalaria ISSN: 1130-6343 http://www.elsevier.es/es/revistas/farmacia-hospitalaria-121

17

Introducción

UNIDAD 1. LOS SERES VIVOS La unidad introduce al estudiante en el desarrollo histórico de la disciplina y en la definición de la vida como aspecto diferencial respecto a los seres inertes, basado en un patrón de autopoiesis como expresión del fenómeno sistémico de la vida. Analiza la estructura, función y sistemática de los seres vivientes en sus diferentes niveles de organización: molecular, celular, tisular, organístico, sistémico y de especie.

Justificación

Competencias

Presenta los modelos funcionales de microorganismos, organismos vegetales y animales y la forma de identificarlos con aplicación de una taxonomía científica La comprensión biológica de los fenómenos de la vida exige comprender la estructura y función de los seres vivos, sus niveles de organización para interpretar las características de las especies biológicas y la forma racional de relacionarnos con ellas. 1. El estudianteexplica los fundamentos que plantean el origen de la vida 2. El estudiante interpreta la teoría celular y los procesos celulares y de división celular 3. El estudianteanaliza y argumenta las relaciones entre estructura y función de cada órgano. 4. El estudiante identificalas relaciones y las diferencias entre macroorganismos y microorganismos

Propósito

Contribuir a la comprensión del estudiante sobre la organización de la vida en la biosfera mediante el estudio sistemático de las características de los organismos vivos, su estructura, función y diversidad

Objetivos

1. Que el estudiante identifique y describalas características de la vida 2. Que el estudiante identifique los niveles de organización de los seres vivos, sus estructuras y funciones. 3. Que el estudiante identifiquelas relaciones y las diferencias entre macroorganismos y microorganismos.

Metas

El estudiante presentará y sustentará en su portafolio de

18

Sistema de interactividades

Sistema de evaluación

desempeño personal a partir de las actividades de autoaprendizaje individual y colaborativo señaladas en la guía de actividadesde la unidad. Para el caso de las actividades de la fase de transferencia, los trabajos deben reflejar la visión crítica del estudiante El curso cuenta con una programación académica de conocimiento previo para el estudiante, con el fin de que planifique y coordine el aprovechamiento de opciones de interacción sincrónica y asincrónica con el tutor, para alcanzar con excelencia los logros o metas de autoaprendizaje planteados. La relación estudiante-estudiante, es un proceso colaborativo de socialización de logros cognitivos reforzados por actividades grupales. La evaluación se concibe como un proceso continuo orientado a verificar las competencias logradas en concordancia con los objetivos del curso académico de Biología. Autoevaluación: La realiza el estudiante al inicio y al final de cada fase de aprendizaje con el fin de identificar las debilidades o vacíos cognitivos, como sus logros o dominios en el abordaje de la biología. Coevaluación:Es un proceso de trabajo colaborativo de los estudiantes en el cual socializan el resultado de sus construcciones personales de conocimiento y reciben la realimentación de sus compañeros, sustentan sus puntos de vista, asimilan nuevos enfoques y ajustan sus planteamientos con el enriquecimiento conceptual logrado en el dialogo de saberes. Heteroevaluación:Es una evaluación sumativa coordinada a nivel nacional en cuanto a fechas y contenidos, además de la revisión y realimentación por parte del tutor sobre las construcciones cognitivas registradas sistemáticamente en el portafolio de desempeño personal (PDP).

19

Recursos Tecnológicos

Las actividades están centradas en el estudiante como autogestor de los procesos de aprendizaje, por lo cual se establece una sinergia de medios y mediaciones el estudiante aprovechará:  El computador como herramienta informática para estudio con CD ROM, con informaciones visuales, auditivas y de texto escrito.  El computador como canal electrónico hacia links hipertextuales en ambientes virtuales de autoaprendizaje, útiles para gestión de conocimiento actualizado.  Sistemas y plataforma tecnológica institucional para videoconferencias y audioconferencias.  Protocolo académico, guía de actividades de aprendizaje, módulo, fuentes hipertextuales de consulta, para estudio temático y orientación pedagógica.  Programación de eventos de socialización y trabajo colaborativo y sesiones de asesoría.  Eventos de prácticas de laboratorio de carácter obligatorio en el curso.  Interacciones programadas en aula virtual.  Simulación de microscopía óptica Capítulo 1. Origen y La explicación se basa en el análisis de eventos en la caracteristicas de los línea del tiempo evolutivo desde el origen de las seres vivos primeras arqueobacterias hasta la biodiversidad actual, con los elementos que caracterizan a los seres vivos Lección 1. El comienzo de la Se analizan las diversas teorías sobre el origen de la vida vida, para que el estudiante reflexione y asuma una posición científica al respecto. Lección 2. Experimento de Miller demuestra la teoría de Oparin al reproducir en el Miller laboratorio la atmosfera primitiva para explicar el origen de la vida Lección 3. La evolución La comprensión de la evolución celular es la primera celular base para entender la biodiversidad actual. Lección4. Descripción y Diferenciar los seres vivos de los seres inertes, permite características de los seres comprender mejor en qué consiste el fenómeno de la vivos vida y cuáles aspectos se deben asegurar para mantenerla Lección 5. Estructura y La comprensión de un organismo vivo, parte del análisis función de los seres vivos de sus componentes dinámicamente articulados en sus aspectos anatomo-fisiológicos.

20

Capítulo 2: Niveles de organización de la vida

Hay que conocer la célula como unidad estructural de los seres vivos y la forma especializada en que se agrupan las células conformando tejidos para funciones específicas, con el fin de analizar mejor la organización biológica. Lección 6. Historia Teoría La teoría celular aporta los conocimientos claves para Celular y Microscopía entender la unidad vital de los organismos. Los procesos celulares de construcción y de eliminación permiten aclarar los aspectos básicos del funcionamiento en los organismos vivos. El microscopo óptico permite identificar la estructura de la célula para comprender mejor la teoría celular. Lección 7. Estructura y El conocimiento de la estructura y función en los función en procariotas diferentestipos de célula permite comprender mejor el por qué de las diferencias entre los dominios y reinos de la vida. Lección 8. Estructura y Cada organelo celular cumple funciones muy función en eucariotas importantes y el análisis de sus roles en el funcionamiento integral de la célula permite comprender mejor los fenómenos de la vida Lección 9. Procesos Los procesos de metabolismo, anabolismo y Celulares catabolismo, explican la mayor parte de la dinámica observable en los seres vivos. Lección 10. División celular- Esta lección aclara la comprensión del crecimiento Mitosis mediante el estudio de la división celular y la organización de las nuevas células en tejidos.La comprensión del mecanismo de reproducción sexual en las células, mediante las fases de la meiosis, aporta la fundamentación esencial la reproducción biológica en general Capítulo Este capítulo Identifica las estructuras, funciones y 3OrganismosPluricelulares relaciones y las diferencias entre macroorganismos y y Unicelulares microorganismos Lección 11. Tejidos animales El estudio de la estructura y funciones delos tejidos animales permite comprender a fondo la organización animal Lección 12. Tejidos El estudio de la estructura y funciones delos tejidos Vegetales vegetales permite comprender a fondo la organización de las plantas Lección 13. Estructura y Presenta la estructura y función de los diferentes Funciones Animales órganos y sistemas animales Lección 14. Estructura y Presenta la estructura y función de los diferentes Funciones Vegetales órganos y sistemas vegetales

21

Lección 15. Los Microorganismos

Presenta los modelos funcionales de microorganismos, organismos vegetales y animales y la forma de identificarlos con aplicación de una taxonomía científica. Es necesario entender los microorganismos para solucionar problemas de salud, problemas industriales y problemas de contaminación

22

UNIDAD 1 SERES VIVOS

Capítulo 1 Origen y características Actividad de reconocimiento En la siguiente dirección encontrará un crucigrama para que usted se autoevalúe sobre los conceptos básicos y previos que debe poseer para comenzar el proceso de estudio y el desarrollo de las actividades posteriores de la unidad 1 de una manera óptima. http://www.freewebs.com/martavinasco/biologia/BIO_CRUCIGRAMA_GLOSARIO. htm

Lección 1 El comienzo de la vida Según los cálculos más modernos, la Tierra se formó hace unos 4.500 millones de años y un millón de años después aparecería la vida. En 1924, el bioquímico Alexander Oparin formuló su hipótesis sobre el origen de la vida a partir moléculas inorgánicas que se encontraban en una atmósfera gaseosa, carente de oxígeno y sin capa de ozono que filtrara los rayos ultravioletas.

23

Figura 3 Origen de la vida. Fuente: diseñado por Carmen Eugenia Piña L.

La energía de descargas eléctricas producidas durante grandes tormentas o la radiación ultravioleta facilitó la unión de las moléculas inorgánicas de la atmósfera primitiva como: dióxido de carbono CO2, metano CH4, hidrógeno H2, nitrógeno N2, ácido clorhídrico HCl, sulfuro de hidrógeno, H2S, amoníaco NH3 y vapor de agua para formar aminoácidos, azúcares, ácidos grasos y nucleótidos . Estas moléculas orgánicas simples a su vez sintetizaron proteínas y ácidos nucleicos.Las lluvias llevaron las moléculas orgánicas a los mares y lagos, donde se concentraron y formaron lo que se denominó una sopa primitiva. Dentro de esta sopa primitiva pequeñas gotas de material lipídico fueron rodeadas por agrupaciones de moléculas orgánicas. Eventualmente las gotas de lípidos pudieron incorporar a su estructura nuevos materiales de las moléculas orgánicas que las rodeaban, con un proceso simultáneo de liberación de la energía almacenada en las moléculas orgánicas. La repetición de este proceso permitió un crecimiento de las agrupaciones moleculares que al separarse de la solución acuosa formaron coacervados que alcanzaban cierta estabilidad para generar procesos metabólicos simples, crecer y reproducirse formando coacervados hijos que a veces conservaban las propiedades químicas de su progenitor, lo cual prefiguró un rudimento de herencia, que permite hablar de un modelo para el inicio de la vida. Oparin estudió la acción de selección natural sobre gotas de coacervados que consiguieron captar del medio los catalizadores adecuados para llevar a cabo procesos metabólicos que aseguraran estabilidad, crecimiento, reproducción y predominio sobre las demás. Estos procesos serían la base para la formación de células ancestrales y posteriormente de organismos más complejos.La comunidad científica de entonces ignoró sus ideas.

Actividad de Profundización La lección anterior sobre el comienzo de la vida permite concluir que: la

24

capacidad de la materia del cosmos primigenio para generar reacciones conducentes a la formación de moléculas orgánicas, aprovechó condiciones aptas en la tierra para dar origen a la vida, lo cual es planteado A. En las dos teorías la de Oparín y la del meteorito Murchison B. Solo por la teoría del meteorito Murchison C. Solo por el experimento de Miller. D. Solo por la teoría de Oparín

Actividad de Transferencia Existen varias teorías para explicar el origen de la vida. Estas teorías han sido explicadas en diferentes épocas de acuerdo con el conocimiento existente en cada una de ellas. Elabore un esquema en orden cronológico con cada una de las teorías sobre el origen de la vida y la explicación y las aportaciones a la actual teoría. Según su criterio la actual teoría sobre el origen de la vida ya está terminada o va a cambiar explique por qué?

Lección 2 Experimento de Miller Actividad de Reconocimiento Observe la siguiente animación Animación, redacte un párrafo donde explique con sus palabras en qué consistió el experimento de Miller. Luego compruebe sus aciertos leyendo el texto y observando el video correspondientes a la lección 2 En 1950 un estudiante de la Universidad de Chicago, Stanley Miller, probó la hipótesis de Oparin.Stanley Miller demostró en el laboratorio, utilizando un aparato diseñado por él, los mecanismos por los cuales los rayos producidos por descargas eléctricas pudieron afectar la atmósfera terrestre primitiva y a partir de la combinación de elementos inorgánicos la posibilidad de formar los precursores de sustancias orgánicas. Para ello en un recipiente de cristal diseñado para simular las condiciones de los océanos y mares primitivos sometió a descargas eléctricas una mezcla de gases con composición parecida a la de la atmósfera terrestre primitiva (CH4, NH3, H2, N2 y vapor de agua). Luego la mezcla fue enfriada y condensada.El resultado fue la formación de una serie de moléculas orgánicas como aminoácidos y otros componentes orgánicos. La siguiente etapa

25

de formación de vida fue la síntesis abiótica de polímeros orgánicos con la formación de proteínas, lípidos, carbohidratos y ácidos nucleicos En la actualidad, es de alta resonancia internacional una teoría aparentemente "contendiente" desarrollada por un grupo de científicos del departamento de biología de la Universidad Estatal de California, Fresno, quienes están realizando investigaciones con el meteorito Murchison (que se cree formó parte de un cometa) el cual contiene algunos aminoácidos similares a los obtenidos por Miller. Se plantean entonces dos posibles orígenes de las primeras moléculas orgánicas que dieron inicio a la evolución de la vida en la tierra: un origen endógeno terrestre, al estilo del experimento de Miller, y un origen extraterrestre, aportado por los meteoritos tipo Murchison. Otra opción sería que estos dos mecanismos coexistieron y se complementaron. En todo caso, cualquiera de las dos teorías permite concluir positivamente sobre la capacidad de la materia del cosmos primigenio para generar reacciones conducentes a la formación de moléculas orgánicas, las cuales encontraron en la tierra condiciones aptas para dar origen a la vida. Para saber más Ver video en esta dirección: http://www.youtube.com/watch?v=w9kiP7knmdg&feature=player_embedded

Figura 4. Experimento de Miller. Fuente: diseñado por Carmen Eugenia Piña L. 1. Agua 2. Calor 3. Vapor de agua 4. Entrada de gases. 5. Matraz con mezcla de gases simulando atmósfera 6. Descargas eléctricas (electrodos de tungsteno) 7. Condensador de agua (enfriamiento) 8. Erlemeyer con moléculas orgánicas.

26

Actividad de Profundización 1. El primer conjunto de hipótesis verificables acerca del origen de la vida fue propuesto por el bioquímico ruso A.I. Oparin y por el inglés J. B. Haldane, quienes trabajaban en forma independiente. Según estos científicos, la aparición de la vida fue precedida por un largo período de tiempo en donde ocurrió lo que a veces se denomina evolución química. Esta teoría fue demostrada 30 años después por: A.

Stanley Miller, simuló las condiciones que se suponía existían en la Tierra primitiva en el laboratorio. B. Charles Darwin en la publicación contenida en el célebre tratado de El origen de las especies. C. Louis Pasteur a través de la demostración de la teoría de los gérmenes. D. Svante August Arrhenius la teoría de la disociación electrolítica la cual explica que los compuestos químicos disueltos, se disocian en iones.

Actividad de Transferencia Indague sobre la atmósfera en Marte y en Venus , compárelas con la atmósfera de la tierra y argumente si puede existir vida en estos otros planetas

Lección 3 Evolución Celular Actividad de Reconocimiento En el siguiente mapa conceptual se resume el proceso de la evolución celular. Utilice el mapa conceptual para responder a la siguiente pregunta:

27

Las células Anaerobias - Heterótrofas son aquellas que: A. utilizan moléculas diferentes al O2 para sus procesos respiratorios y se nutren de moléculas orgánicas B. se nutren de materia orgánica y utilizan O2 en sus procesos respiratorios C. no utilizan el O2 en los procesos respiratorios y no pueden sintetizar su propio alimento D. se nutren de materia inorgánica y utilizan O2 en sus procesos respiratorios

28

Luego puede comprobar su respuesta realizando la lectura evolución celular

Evolución celular -Las células primitivas El proceso de evolución celular es un resultado paralelo de la evolución en las condiciones de la atmósfera primitiva hacia la atmósfera actual. Con base en el enfoque evolutivo del biólogo molecular Carl Woese, las células primitivas para ser consideradas unidades vivientes, de alguna manera debían contar con un mecanismo que permitiera realizar procesos de transcripción genética. A esta célula primitiva precursora de los diversos tipos de células vivientes, la denominó protobionte, y por ser el antepasado común de todos los organismos genéticamente codificados, también la denominó progenota. Con base en el proceso esquematizado en el mapa conceptual se pueden ilustrar las etapas evolutivas de la célula procariota primitiva en el siguiente diagrama:

Figura 6: Etapas evolutivas de la célula procariota primitiva Fuente: diseñadas por Carmen Eugenia Piña L.

La teoría endosimbiótica La teoría endosimbiótica propuesta por la científica Lynn Margulis explica el origen de las células eucariotas a partir de la evolución de células procariotas primitivas así:Alguna célula procariota primitiva perdió su pared celular rígida quedando rodeada por la membrana plasmática que al presentar una estructura más flexible fue replegándose aumentando de esta manera su superficie membranosa con el consecuente aumento del tamaño de la célula.

29

Figura 7 Proceso evolutivo planteado por la teoría endosimbiótica Fuente: diseñadas por Carmen Eugenia Piña L

A esta célula procariota de mayor tamaño y carente de pared celular se le llamó urcariota.

Fuente: diseñadas por Carmen Eugenia Piña L

De acuerdo con esta teoría, la célula urcariota por el mecanismo de fagocitosis ingirió pero no digirió otras células procariotas de menor tamaño tipo bacteria con las cuales estableció una relación de mutua colaboración llamada endosimbiosis vivir juntas dentro-

Fuente: diseñadas por Carmen Eugenia Piña L

Una de estas asociaciones fue la que se estableció entre la célula urcariota y algunas bacterias aerobias en donde la célula urcariota anaerobia heterótrofa

30

suministraba a la bacteria aerobia algunos componentes orgánicos para su nutrición y la bacteria aerobia a su vez permitió a la urcariota utilizar el oxígeno y realizar la respiración aerobia o metabolismo oxidativo. La estabilización evolutiva de la ventajosa y competitiva interacción urcariota-bacteria aerobia, generó a partir de la bacteria aerobia la estructura actual (organelo) presente como mitocondria en las células animales y vegetales.

Fuente: diseñadas por Carmen Eugenia Piña L

Otra combinación ventajosa la constituyó la incorporación de bacterias fotosintéticas -cianobacterias- a la célula urcariota.

Fuente: diseñadas por Carmen Eugenia Piña L

Igualmente la estabilización evolutiva de la ventajosa y competitiva fusión urcariota-bacteria fotosintética, generó a partir de la bacteria fotosintética la estructura actual (organelo) presente como cloroplasto presente en las células vegetales.

Fuente: diseñadas por Carmen Eugenia Piña L

31

El origen de los organelos denominados peroxisomas presentes en las células eucariotas se cree partió de bacterias huéspedes en la célula urcariota capaces de eliminar residuos tóxicos como el agua oxigenada. El núcleo rodeado de membrana nuclear presente en las actuales células animales y vegetales se generó de alguna célula del tipo arqueobacteria o Archaeabacteria, al incorporarse en la célula hospedadora. De igual manera se piensa que la fusión de urcariotas con bacterias como las espiroquetas dio origen a los cilios y flagelos de las células eucariotas. Por otra parte como consecuencia de las invaginaciones de la membrana plasmática se formaron compartimentos de doble membrana que fueron rodeando cada tipo de bacteria origen de los organelos.

Figura 7 Proceso evolutivo planteado por la teoría endosimbiótica Fuente: diseñadas por Carmen Eugenia Piña L

Actividad de Profundización 1. La teoría endosimbiótica propuesta por Lynn Margulis explica el origen de las células eucariotas a partir de células procariotas primitivas así:

A. Una célula primitiva perdió su pared celular rígida y aumento su tamaño, a esta célula se le llamó eucariota. B. Por la formación invaginaciones de la membrana plasmática de la célula primitiva C. Al aumentar el tamaño de la célula urcariota como consecuencia de la pérdida de la pared celular D. Se produjo una interacción evolutiva entre las urcariotas y bacterias aerobias 2. Alguna célula procariota primitiva perdió su pared celular rígida quedando rodeada por la membrana plasmática que al presentar una estructura más flexible fue replegándose aumentando de esta manera su superficie membranosa con el consecuente aumento del tamaño de la célula. A esta célula se le conoce como: A. B. C. D.

Procariota Célula animal Urcariota Eucariota

32

Actividad de Transferencia Ahora que ya ha leído la lección y observado las Figuras redacte un audio que explique la siguiente animación. De clic en ANIMACION

Lección 4 Estructura y función de los seres vivos Actividad de Reconocimiento ¿En que se parecen un hombre, una vaca, una planta y una bacteria? ¿En qué se diferencian de una gota de agua o un cristal de sal? En todos los procesos que involucren seres vivos, recursos de biodiversidad o simulaciones como en el caso de transferencia por redes neuronales y procesos inteligentes en general, se requiere conocer la estructura y función a nivel macro y micro de los seres vivos, como una forma fundamental para la comprensión de la realidad y para la gestión sostenible del entorno. La estructura se analiza por niveles de organización que normalmente se discriminan en genético a nivel de gen; celular células, tisular: los tejidos resultantes del conjunto de células especializadas; el organístico donde los tejidos conforman un órgano que desempeña una o varias funciones y sistémico como el sistema digestivo donde un conjunto de órganos cumplen un mismo propósito o función por ejemplo la digestión. Un nivel superior es el de los organismos, pero la biología además de estudiarlos individualmente los analiza también como componentes de ecosistemas y como resultado de la evolución de las especies. Por el lado de la función, el estudio de la biología analiza las condiciones en que se mantienen procesos de equilibrio biológico interno y en relación con el ambiente o sea la homeostasia y analiza sobre el particular, la dinámica de poblaciones o sea la sinergia de los organismos para buscar su preponderancia y sostenibilidad dentro de nichos específicos de los ecosistemas en el proceso de evolución de las especies. ¿Qué son los seres vivos? El pensamiento de Maturana tiene su punto central en el concepto de "autopoiesis": (...) los seres vivos son verdaderos remolinos de producción de componentes, por los que las sustancias que se toman del medio, o se vierten en

33

él, pasan participando transitoriamente en el interrumpido recambio de componentes que determina su continuo revolver productivo. Es esta condición de continua producción de sí mismos, a través de la continua producción de recambio de sus componentes, lo que caracteriza a los seres vivos, y lo que se pierde en el fenómeno de la muerte. Es a esta condición a la que me refiero al decir que los seres vivos son sistemas autopoiéticos, y que están vivos sólo mientras están en autopoiesis. (Biología del fenómeno social, p. 5) Los seres vivos tienen dos "dominios operacionales": el que llamaríamos interior, el de su "dinámica estructural", su fisiología, y el del "entorno", que se manifiesta en unas "conductas" determinadas. Desde esta perspectiva, "la historia individual u ontogenia de todo ser vivo transcurre, o se da, constitutivamente como una historia de cambios estructurales que siguen un curso que se establece momento a momento determinado por la secuencia de sus interacciones en el medio que lo contiene" (Origen de las especies por medio de la deriva natural, p. 110). Los sistemas vivos, todos los organismos, de los más simples a los más complejos, "son sistemas estructuralmente determinados, y nada externo a ellos puede especificar o determinar qué cambios estructurales experimentan en una interacción; un agente externo, por lo tanto, puede sólo provocar en un sistema vivo cambios estructurales determinados en su estructura" (Biología de la experiencia estética, p. 43). Esto significa básicamente que son los organismos los que modifican su propia estructura. Los elementos exteriores no pueden producir modificaciones de las estructuras; las estructuras se van modificando, pero por medio de cambios desde el interior. No es el entorno el elemento que modifica la estructura, ya que los cambios son cambios que provienen del interior BIOLOGÍA DEL FENÓMENO SOCIAL [i] Humberto Maturna R. Entrevista ecovisiones nº 6

¿Qué caracteriza son los seres inertes o componentes abióticos? Los seres inertesse caracterizan por: º Presentar una estructura simple de enlaces quimicos y ordenamiento atómico, no poseen ni células,ni órganos, ni sistemas º Carecer de metabolismo sobremateriales externos que entren en contacto. º Mantener su estructuracon base en unicamente en su resistencia física y química. º Tener un crecimientopor adherencia geometricamente organizada en condicionesfisico-quimicas. Porejemplo, la formacion de rocas. º No presentar respuesta autónoma a estimulos del medio. º No se reproducen

34

Actividad de Profundización Elabore un mapa conceptual socialícelo en pequeño grupo colaborativo a través del aula Virtual y luego incorpore ajustes basados en la realimentación resultante de la socialización. En su ejercicio deben aparecer como mínimo los siguientes conceptos que se encuentran sin orden jerárquico y que usted debe reordenar y organizar jerárquicamente agregando las palabras enlace y los conectores Autopoiesis, estructuras, componentes, interior, producción, cambios, seres vivos, modificaciones , entorno, interior , organismos, condición, fisiología, conducta, exterior

Actividad de Transferencia Indague cuál es la importancia de los seres inertes en la naturaleza. Socialice su respuesta con la de sus compañero y tutor.

Lección 5 Descripción de las características de los seres vivos Actividad de Reconocimiento Observe los siguientes videos : El umbral de la vida parte 1: http://www.youtube.com/watch?v=ReUjkwAESg0&feature=related

El umbral de la vida parte 2 http://www.youtube.com/watch?v=2YeJoyFQnW8&feature=related

Según lo observado en los dos videos se puede señalar que hay unas pocas características fundamentales que permiten diferenciar a los seres vivos de las cosas no vivas. Las conclusiones obtenidas de la explicación de los videos permiten responder la siguiente pregunta. Un ser se considera vivo cuando cumple las dos condiciones siguientes: 1. Se origina a partir de una célula 2. Tiene capacidad de movimiento 3. Se reproduce mediante ADN y ARN 4. Presenta estados de crecimiento

35

Reproducción

Figura 8 Reproducción Tomado de Microsoft Encarta

Uno de los principios fundamentales de la biología es que "toda vida proviene exclusivamente de los seres vivos". Cada organismo sólo puede provenir de organismos preexistentes. La autoperpetuación es una característica fundamental de los seres vivos. Movimiento Todos los seres vivos son capaces de moverse. Este movimiento no debe confundirse con el desplazamiento: un objeto se desplaza cuando cambia su posición dentro de un marco referencial, en cambio un ser vivo se puede mover sin cambiar de ubicación. El movimiento de locomoción de los animales es muy obvio: se agitan, reptan, nadan, corren o vuelan. Las plantas tienen movimientos más lentos, por ejemplo: los tropismos, las nastias y los seguimientos solares. Los tropismos son respuestas de crecimiento de las plantas a estímulos como la luz en este caso hablamos de fototropismo que puede ser negativo si se aleja del estímulo como en el caso de las raíces, o positivo como ocurre con las hojas o tallos que se orientan hacia la luz. Otro tipo de tropismo es el geotropismo que es una respuesta a la gravedad, puede ser positivo como el que presentan las raíces que son atraídas hacia el centro de la tierra o negativo como en el caso de los tallos que crecen erguidos en contra de la gravedad. Las nastias ocurren independientemente del estímulo por ejemplo: cuando las flores se cierran en la noche.Los seguimientos solares cuando las plantas orientan sus hojas o flores en dirección a la luz solar, como ocurre con la flor del girasol o del algodón.Otra clase de movimiento es el flujo del material vivo en el interior de las células de las hojas de las plantas conocido como ciclosis.

36

Para saber más Animación de Tropismo Negativo

Adaptación Esta característica se refiere a la capacidad de todos los seres vivos para adaptarse a su ambiente y así poder sobrevivir en un mundo en constante cambio. Las modificaciones que el organismo realiza frente a estímulos del medio interno y externo para adaptarse pueden ser estructurales, conductuales o fisiológicas o una combinación de ellas. Es decir, la adaptación es una consecuencia de la irritabilidad. La adaptación trae consigo cambios en la especie, más que en el individuo. Si todo organismo de una especie fuera exactamente idéntico a los demás, cualquier cambio en el ambiente sería desastroso para todos ellos, de modo que la especie se extinguiría. La mayor parte de las adaptaciones se producen durante periodos muy prolongados de tiempo, y en ellas intervienen varias generaciones. Las adaptaciones son resultado de los procesos evolutivos.

Figura 9 Adaptaciones Tomado de Microsoft Encarta

El cactus tiene pliegues en forma de acordeón con los que pueden dilatarse para almacenar la mayor cantidad de agua posible y sus espinas no solamente lo protegen del sol y de los animales sedientos. Los pingüinos tienen unas adaptaciones únicas externas que les ayudan a conservar este calor Irritabilidad Los seres vivos reaccionan a los estímulos, que son cambios físicos o químicos en su ambiente interno o externo. Los estímulos que evocan una reacción en la mayoría de los organismos son: cambios de color, intensidad o dirección de la luz;

37

cambios en temperatura, presión o sonido, y cambios en la composición química del suelo, aire o agua circundantes. En los animales complejos, como el ser humano, ciertas células del cuerpo están altamente especializadas para reaccionar a ciertos tipos de estímulos; por ejemplo las células de la retina del ojo reaccionan a la luz. En los organismos más simples esas células pueden estar ausentes, pero el organismo entero reacciona al estímulo. Ciertos organismos celulares reaccionan a la luz intensa huyendo de ella. La irritabilidad de las plantas no es tan obvia como la de los animales, pero también los vegetales reaccionan a la luz, a la gravedad, al agua y a otros estímulos, principalmente por crecimiento de su cuerpo. El movimiento de flujo del citoplasma de las células vegetales se acelera o detiene a causa de las variaciones en la intensidad de la luz. Complejidad estructural Los seres vivos poseen una complejidad estructural única para poder desarrollar todas sus actividades. Esta complejidad es mantenida gracias al flujo constante de materia y energía que pasa por los organismos. Metabolismo Es el conjunto de reacciones químicas que ocurren al interior de las células y que le proporcionan a los seres vivos la materia y energía indispensable para desarrollar sus actividades vitales.En todos los seres vivos ocurren reacciones químicas esenciales para la nutrición, el crecimiento y la reparación de las células, así como para la conversión de la energía en formas utilizables. Para mantener el metabolismo, los organismos recurren a otras características secundarias como la nutrición, excreción y respiración.Las reacciones metabólicas ocurren de manera continua en todo ser vivo; en el momento en que se suspenden se considera que el organismo ha muerto. Homeostasis Es la capacidad de todos los seres vivos de mantener constante las condiciones físicas y químicas de su medio interno. La tendencia de los organismos a mantener un medio interno constante se denomina homeostasis, y los mecanismos que realizan esa tarea se llaman mecanismos homeostáticos. La regulación de la temperatura corporal en el ser humano es un ejemplo de la operación de tales mecanismos. Cuando la temperatura del cuerpo se eleva por arriba de su nivel normal de 37°C., la temperatura de la sangre es detectada por

38

células especializadas del cerebro que funcionan como un termostato. Dichas células envían impulsos nerviosos hacia las glándulas sudoríparas e incrementan la secreción de sudor. La evaporación del sudor que humedece la superficie del cuerpo reduce la temperatura corporal. Otros impulsos nerviosos provocan la dilatación de los capilares sanguíneos de la piel, haciendo que esta se sonroje. El aumento de flujo sanguíneo en la piel lleva más calor hacia la superficie corporal para que desde ahí se disipe en radiación.Otro ejemplo lo constituyen las plantas, cuando les falta agua cierran los estomas de sus hojas evitando la pérdida de agua por evaporación. Crecimiento Todos los seres vivos crecen a lo largo de su vida. En el crecimiento interviene la síntesis de nuevas sustancias a partir de alimento tomado del medio. El crecimiento se produce por la expansión celular y por división celular.El crecimiento implica un aumento del tamaño. Los individuos pluricelulares crecen por aumento en la cantidad de células que los componen (si bien en los organismos unicelulares se registra un crecimiento por aumento del tamaño de su célula, esto es hasta un límite definido, en el cual la célula detiene su crecimiento y se divide para formar dos organismos). El desarrollo está relacionado con las transformaciones que sufre un individuo a lo largo de su vida. Así, las células de un individuo pluricelular adquieren diferentes formas de acuerdo a su función. Actividad de Profundización 1. Una respuesta de una planta a estímulos del medio ambiente implica un movimiento de parte de la planta, el cual se conoce como tropismo. Si la respuesta es hacia el estímulo se dice que es un tropismo positivo, si es en sentido contrario, negativo. El movimiento de las plantas en respuesta a la gravedad está considerado como: A. B. C. D.

Geotropismo Nastia. Ciclosis Fototropismo

2. Es el conjunto de reacciones químicas que ocurren al interior de las células y que le proporcionan a los seres vivos la materia y energía indispensable para desarrollar sus actividades vitales. A.

Transporte activo

B. C. D.

Metabolismo Reproducción Homeostasis

39

Actividad de Transferencia Indague cuál es la composición atómica de los seres vivos. ¿Todos los seres vivos tienen la misma composición?

Capítulo 2 Niveles de organización de la vida Lección 6 La célula –Historia Actividad de Reconocimiento En está dirección encuentra una actividad para explorar sus conocimientos previos sobre Antecedentes históricos de la Teoría Celular de clic http://www.lourdes-luengo.org/actividades/5-3antecedentes.htm

Gracias a la invención del microscopio se hizo posible investigar cómo son las células y los descubrimientos sobre la estructura celular que tuvieron lugar a lo largo del siglo XVII marcan una verdadera revolución científica y dan origen a la Biología moderna. El inglés Robert Hooke (1637-1703) fue el primero que utilizó el término "célula" en 1665 para referirse a los compartimentos vacíos semejantes a celdas que observó a través del microscopio en una lámina de corcho. Hooke observó células secas, después de muchos años los investigadores determinaron que las células no estaban vacías sino llenas de sustancia acuosa. En 1673, Anton Van Leeuwenhoeck realizó observaciones de células vivas como eritrocitos y espermatozoides, igualmente al examinar agua de los charcos vio por primera vez organismos microscópicos. Después del perfeccionamiento del microscopio en 1838 el botánico alemán Mathias Schleiden al observar al microscopio tejidos vegetales concluyó que estaban formados por células y que el embrión de una planta tuvo su origen a partir de una sola célula.

40

Un año más tarde el zoólogo alemán Theodor Schwann en sus estudios microscópicos de tejidos animales y vegetales determina que los tejidos animales están constituidos por células, y que las células de plantas y animales presentan estructuras semejantes. Estos alemanes planteraon los dos primeros postulados de la teoría celular, afirmando que todos los organismos vivos están constituidos por células y que la célula es la unidad estructural. En 1859 el biólogo alemánRudolf Virchow propuso que todas las células vienen de células preexistentes: omnis cellula e cellula. La teoría celular La teoría celular moderna se resume en tres postulados: 

La célula es la unidad básica estructural de todos los seres vivos, todos los organismos están formados por células. 

La célula es la unidad funcional de todos los organismos. Todo el funcionamiento del organismo depende de las funciones que ocurren al interior de la célula, respiración, reproducción, digestión, crecimiento entre otras. 

Todas las células se originan por la división de células preexistentes (en otras palabras, a través de la reproducción). Cada célula contiene material genético que se transmite durante este proceso.

MICROSCOPÍA El Microscopio óptico simple Constituido por una lente biconvexa única o lupa que hace converger los rayos luminosos que la atraviesan en un punto denominado foco y a una distancia focal muy corta. El Microscopio óptico Compuesto El microscopio se define como un instrumento óptico formado por un sistema de lentes: objetivos y oculares que amplían los objetos extremadamente pequeños para posibilitar su observación. La lente del objetivo proporciona una imagen intermedia ampliada del objeto, es decir, funciona como una lente simple, y la lente del ocular que recoge la imagen dada por el objetivo y la aumenta.

41

El Microscopio electrónico Este microscopio electrónico en lugar de una fuente de luz, utiliza un haz de electrones que se desplazan en el vacío y en línea recta. Con el microscopio electrónico es posible observar objetos muy pequeños como los virus que no pueden ser resueltos con el microscopio óptico.En el microscopio electrónico en lugar de lentes se emplean campos magnéticos que enfocan los haces de electrones. El Microscopio óptico Compuesto: componentes A continuación se describen las partes que lo conforman:

Figura 10. El Microscopio y sus partes Fuente: Carmen Eugenia Piña

Los objetivos:están localizados en la parte inferior del tubo insertados en una pieza metálica, denominada revólver o porta objetivos, que permite cambiarlos fácilmente. Estos generan una imagen real, invertida y aumentada, esta imagen intermedia es captada y sufre una nueva ampliación por el ocular. Los objetivos más frecuentes son los de 4X, 10X, 40X y 100X aumentos. Este último de 100x se llama de inmersión ya que para su utilización se necesita aplicar aceite de cedro sobre la preparación. Y se utiliza para observar láminas coloreadas completamente secas. El poder de aumento de cada objetivo se indica en el número grabado en la manga del lente. Generalmente el objetivo de 4X se encuentra marcado por un

42

anillo rojo, el de 10X por un anillo de color amarillo, el de 40=x con un anillo de color azul y el de 100X con un anillo de color blanco.

Figura 11 Objetivos

La abertura numérica se encuentra (A.N.) se encuentra grabada en la manga del objetivo, junto a la indicación del aumento. 0,30 0,65 1,30

En el objetivo de 10X En el objetivo de 40X En el objetivo de 100X

A medida que aumenta la A.N. disminuyen las dimensiones de la lente frontal, montada en la base del objetivo. La lente del objetivo de 100x tiene el tamaño de una cabeza de alfiler es mayor el poder de resolución. Además a medida que aumenta A.N. es mayor el poder de resolución. Cuanto mayor sea el poder de resolución del objetivo, será más clara la imagen y aumentará la capacidad de poner de manifiesto detalles adyacentes muy cercanos, separándolos y aclarándolos. El poder de resolución máximo de un buen microscopio es aproximadamente 0,25 nanómetros, el poder de resolución del ojo humano es de 0,25 milímetros Los oculares se denominan así porque están muy cercanos al ojo. Su función es la de captar y ampliar la imagen formada en los objetivos. El poder de aumento del ocular se encuentra marcado en el ocular. Un ocular por 4 aumenta 4 veces la imagen que produce el objetivo. Un ocular por 6 la aumenta 6 veces. Un ocular por 10 la aumenta 10 veces Nunca se deben tocar las lentes con las manos. Si se ensucian, se deben limpiar muy suavemente con un papel de óptica

Figura 12 Ocular

El tubo óptico: es una cámara oscura unida mediante una cremallera. Tiene el revólver con los objetivos en su parte inferior y los oculares en el extremo superior.

43

El Brazo: es una columna perpendicular al pie. Puede ser arqueado o vertical y une al pie con el tubo. La Platina

Figura 13.Platina. Fuente Carmen Eugenia Piña

Es una plataforma horizontal con un orificio central, sobre el que se coloca la preparación, que permite el paso de los rayos procedentes de la fuente de iluminación situada por debajo. Dos pinzas sirven para retener el portaobjetos sobre la platina y un carro con un sistema de cremallera guiado por dos tornillos de desplazamiento que permite mover la preparación de delante hacia atrás o de izquierda a derecha y viceversa. Está dotado de una escala graduada para medir de forma precisa las observaciones.

El condensador: es un sistema de lentes convergentes situadas bajo la platina, su función es la de concentrar la luz generada por la fuente de iluminación hacia la preparación.

Figura 14Condensador y Diafragma. Fuente Carmen Eugenia Piña

Diafragma-iris: Es una cortinilla que regula la cantidad de luz que entra en el condensador, eliminando los rayos demasiado desviados. Se acciona mediante una perilla. Esta situado debajo de la platina, inmediatamente debajo del condensador. La disminución del diafragma permite visualizar partes de protozoos u hongos se utiliza en las preparaciones frescas

44

Figura 15Tornillos Macrométrico y Micrométrico Fuente Carmen Eugenia Piña

Tornillo Macrométrico: Se encuentra en la parte inferior del microscopio. Sirve para alejar o acercar el tubo y la platina moviéndola de arriba hacia abajo y viceversa. Permite un enfoque aproximado o grueso de la muestra. Tornillo micrométrico: Generalmente se encuentra incorporado al tornillo macrométrico. Sirve para dar claridad a la imagen al lograr un ajuste fino y preciso, mediante movimiento de la platina hacia arriba y hacia abajo de forma lenta. Ambos tornillos llevan incorporado un mando de bloqueo que fija la platina a una determinada altura. La fuente de iluminación: se trata de una lámpara halógena de intensidad graduable. Está situada en el pie del microscopio. Se enciende y se apaga con un interruptor y en su superficie externa puede tener una especie de anillo para colocar filtros que facilitan la visualización. Por último definimos el pie o base: sirve como base del microscopio y tiene un peso suficiente para dar estabilidad al aparato. En él se integra la fuente luminosa.

45

Poderes o capacidades del microscopio

Poder de aumento:Permite magnificar la imagen. Corresponde al aumento (A) dado por la relación: Tamaño de la imagen / tamaño del objeto. La ampliación es igual al producto del aumento del lente ocular por el del objetivo. Cada objetivo y cada ocular tienen grabado el número de veces que aumentan la imagen. Si la imagen del objeto, se hace aumentar 40 veces mediante el objetivo y enseguida 10 mediante el ocular, su aumento total será 10X40= 400

¿Cómo se calcula el aumento de una muestra?

Figura 16 Poder de aumento Fuente Carmen Eugenia Piña

Se multiplica el aumento que señala el ocular por el aumento del objetivo dando como resultado el aumento total de la muestra o número de veces en que el objeto se encuentra ampliado con respecto a su tamaño original. Aumento total = aumento del ocular X aumento del objetivo. Poder de definición Es la capacidad del microscopio para formar imágenes nítidas y con contornos definidos

Figura 16a Poder de aumento Fuente Carmen Eugenia Piña

46

Figura 17Poder de penetración o profundidad

Poder de penetración o profundidad Permite visualizar los diferentes planos de una preparación y está dado por el ajuste de precisión que se logra con el tornillo micrométrico Poder de resolución Es la capacidad de presentar dos puntos que se encuentran muy cercanos entre sí como separados, lo cual permite observar detalles de los objetos que con el ojo humano no se podrían ver. El ojo humano no puede ver separados dos puntos cuando su distancia es menor a una décima de milímetro. Con el Microscopio óptico, el poder separador máximo es de 0,2 décimas de micra. Mejora la visión unas 500 veces con relación a la del ojo humano

Figura 18 Poder de resolución

En la imagen de la izquierda se observan espacios blancos entre la tinta negra que a simple vista no serían vistos En la imagen de la derecha se observan varias fibras de hilo que a simple vista no serían vistas.

47

Figura 19 Objetivo donde se visualiza el aumento y la apertura numérica

El poder de resolución depende de la longitud de onda ( λ ) y de la apertura numérica del objetivo (A.N.) El Poder de resolución esta dado por la formula: Poder de resolución= λ 2x A.N. A.N: relaciona el ángulo de apertura de los rayos de luz, que provienen de la muestra, con el índice de refracción. Principios generales de microscopía Principios ópticos Una lente sencilla (biconvexa) posee dos focos, uno a cada lado de la lente (F y F´). Cuando los rayos luminosos pasan a través de la lente se concentran en el foco. La distancia focal es la distancia entre el centro de la lente y el punto en donde convergen los rayos. La distancia focal de una lente depende del índice de refracción del material del cual está hecha, y del medio que envuelve la lente. Por eso, es diferente la distancia focal de una lente en el agua, que esta misma en el aire. Como también es diferente la distancia focal de una lente de vidrio en comparación con una construida en plástico.

Figura 20 Distancia Focal http://micro.magnet.fsu.edu/primer/java/lenses/simplethinlens/index.html

48

Cuanto más pequeña es la distancia focal de una lente tanto mayor es su aumento. Si el objeto se coloca a distancia mayor del foco, se obtiene una imagen real invertida, mientras que si el objeto se localiza a una distancia menor del foco la imagen será virtual. A medida que se aleja el objeto del foco, la imagen se percibe más pequeña.

Figura 21 Distancia Focal http://micro.magnet.fsu.edu/primer/java/lenses/simplethinlens/index.html

La distancia de trabajo focal de un objetivo, es el espacio que existe entre la superficie de la lente del objetivo y la laminilla, una vez se encuentre enfocada la preparación. A mayor aumento del objetivo la distancia de trabajo disminuye. Como determinar la posición de los objetos observados Los objetos que se observan en el campo microscópico se pueden localizar en relación con las manecillas del reloj. Los objetos que aparecen en la parte inferior del fondo del campo microscópico se encuentran realmente en la parte superior.Los objetos en el lado izquierdo del campo microscópico se encuentran realmente al lado derecho.

49

Desplazamiento del objeto Si se mueve el portaobjetos hacia la derecha, el objeto examinado se desplazará hacia la izquierda. Si se mueve el portaobjetos hacia usted, el objeto examinado se alejará. Formación de la imagen real invertida

Figura 22 Formación de la imagen invertida

Las imágenes se observan invertidas por las lentes. Refracción de la luz

Figura 23 Refracción de la Luz

50

Figura 23 Refracción de la Luz

La distancia focal de una lente depende del índice de refracción del material del cual está hecha y del medio que envuelve la lente. Cuando los rayos de luz se mueven en un medio homogéneo como el aire, se propagan en línea recta, pero cuando caen sobre la superficie de un medio de diferente densidad, a la del medio en el cual se venía propagando, cambian de dirección y de velocidad a estos cambios se les conoce como refracción de la luz. Los rayos de luz procedentes de los objetos sumergidos en el agua se desvían al atravesar dos medios de diferente densidad (agua-aire), originando este efecto de refracción. Por ejemplo si introducimos un lápiz en un vaso con agua, el lápiz se verá cortado al pasar del agua al aire. En la práctica de microscopía encontramos diferentes medios: aire, agua aceite de inmersión y vidrio, cuyos índices de refracción son 1.0, 1.33, 1.51, .1.54 respectivamente. Al observar una muestra a través del microscopio, los rayos de luz tienen que atravesar estos medios y son refractados cambiando su dirección.

Figura 24Corrección de la refracción de la Luz

Al aplicar el aceite inmersión se entre el preparado y la lente, aceite de inmersión, que tiene un índice de refracción igual al de la lente y evita la refracción de los rayos luminosos.

51

Campo de Visión

Figura 25Campo de visión Fuente Carmen Eugenia Piña

El campo de visión de un microscopio es la zona circular que se observa al mirar la preparación bajo un determinado aumento. Para medir el campo de visión de un microscopio, se debe usar una unidad llamada micra. Una micra equivale a 0,0001 mm; en otras palabras, hay 1000 micras en un milímetro. El diámetro de este campo es su medida. El campo de visiónde un microscopio es la zona circular que se observa al mirar la preparación bajo un determinado aumento. Para medir el campo de visión de un microscopio, se debe usar una unidad llamada micra. Una micra equivale a 0,0001 mm; en otras palabras, hay 1000 micras en un milímetro. El diámetro de este campo es su medida. Cálculo del diámetro del campo de visión Para calcular el diámetro del campo de visión para un determinado aumento hay que seguir los siguientes pasos:

Figura 26montaje de papel milimetrado Fuente Carmen Eugenia Piña

a) Recortar un cuadrado de 1 cm de lado de papel milimetrado. b) Ponerlo sobre la abertura central del portaobjetos

52

c) Observando por el ocular y con el objetivo de 4X, mover la muestra hasta lograr que la línea 0 mm quede en el borde izquierdo del campo visual

Figura 27Papel milimetrado con aumento de 4X Fuente Carmen Eugenia Piña

d) Enfocar con el objetivo de menor aumento 4X hasta que se vea con claridad. Enfocar la preparación quiere decir situarla a la distancia del objetivo que permite su observación nítida. Esta distancia s e conoce como distancia de trabajo y es tanto menor cuanto mayor es el poder de aumento del objetivo e) Medir el campo visual haciendo coincidir una de las líneas del papel milimetrado con el borde del campo de visión.

Figura 27 aPapel milimetrado con aumento de 4X Fuente Carmen Eugenia Piña

f) Contar el número de milímetros que se ven (recuerde que la distancia entre dos líneas es un milímetro) y estimar aproximadamente la fracción sobrante, si la hay. El resultado será el diámetro del campo visual para ese aumento (objetivo x ocular).

53

g) Si queremos calcular el diámetro del campo de visión para aumentos mayores, hay que tener en cuenta que cuanto mayor sea el aumento, el campo será menor, es decir, se verá menos de la muestra que estemos observando. De forma que, si el aumento es el doble, el campo será la mitad, si el aumento es el triple, el diámetro será la tercera parte, etc. (inversamente proporcionales). Por tanto, bastará con realizar un sencillo cálculo matemático para saber el nuevo diámetro. Tabla 1 Equivalencia mm en micras Medida en mm (escala del portaobjetos)

Equivalencia en µm

Tamaño de las marcas (divisiones)

1mm

1000 µm

grandes

0.1 mm

100 µm

medianas

0.01mm

10 µm

más pequeñas

Preparaciones o montajes Las preparaciones pueden ser de varios tipos: a. Frescas: Son montajes generalmente húmedos. La muestra se observa sin modificar, diluida o concentrada. Permite observar la movilidad de los microorganismos vivos. Se utiliza también para observar procesos como la mitosis, meiosis, la formación d esporas. Para realizar un montaje húmedo se debe verter una gota de agua o del líquido que contiene los microorganismos en el centro de una lámina portaobjetos y cubrirlo con una laminilla cubreobjetos. Para evitar la evaporación se puede sellar el espacio que hay entre el portaobjetos y el cubreobjetos con vaselina o alguna sustancia similar. Frescas ligeramente modificadas: Las muestras se pueden diluir con agua o con agua con sal, esta última evita que la presión osmótica del medio no sea demasiado baja. Se puede aplicar un colorante o reactivo para observar mejor las estructuras. b. Fijadas y teñidas: Se coloca una suspensión homogénea de microorganismos en una gota de agua sobre el portaobjetos y se fija (mediante calor o agentes químicos) y después se tiñen mediante diferentes técnicas. Estas preparaciones se observan sin cubreobjetos y, habitualmente, con objetivos de inmersión

54

Actividad de Profundización PREGUNTAS DE ANÁLISIS DE POSTULADOS La pregunta que encontrará a continuación constan de una afirmación VERDADERA (tesis) y dos postulados también VERDADEROS, identificados con POSTULADO I y POSTULADO II. Usted debe analizar si los postulados se deducen lógicamente de la afirmación y selecciona la respuesta en su hoja de cotejo, conforme a la siguiente instrucción: Marque A si de la tesis se deducen los postulados I y II. Marque B si de la tesis se deduce el postulado I. Marque C si de la tesis sólo se deduce el postulado II. Marque D si ninguno de los postulados se deduce de la tesis.

TESIS: La célula es la unidad fundamental de la vida. Es la estructura más pequeña y altamente organizada del cuerpo capaz de realizar todos los procesos que definen la vida.

POSTULADO I: Las células son autónomas y responsables del funcionamiento de todos los organismos vivos. POSTULADO II: Tiene capacidad de autorregulación, de responder ante diferentes estímulos, de respiración, de movimiento, de digestión, de reproducción, de comunicación.

Actividad de Transferencia De clic en la siguiente dirección y realice la actividad. http://personales.ya.com/geopal/biologia_2b/unidades/ejercicios/act1tctema2.htm

55

Lección 7 Estructura y función en Procariotas y Eucariotas Actividad de Reconocimiento

Compare los dos esquemas y describa las principales diferencias que observa entre ellas.Compare luego sus aciertos al estudiar la lección Figura 28 Comparación celúla procariota y eucariota Fuente Carmen Eugenia Piña

La célula es la unidad fundamental de la vida. Es la estructura más pequeña del cuerpo, capaz de realizar todos los procesos que definen la vida.Las células poseen una estructura altamente organizada, tienen capacidad de autorregulación,

56

de responder ante diferentes estímulos, de respiración, de movimiento, de digestión, de reproducción, de comunicación, aunque no todas las células pueden realizar todas estas funciones. En los organismos unicelulares como los protozoos y las bacterias la célula es autónoma, realiza todas las funciones, mientras que organismos como las plantas y los animales están formados por muchos millares de células organizadas en tejidos y órganos con funciones específicas. La mayoría de las células son invisibles para el ojo humano. Hasta el óvulo femenino, que es la célula más grande del cuerpo, no es más grande que el punto situado al final de esta frase. El tamaño y la forma varían con las funciones celulares.Todas las células constan de tres partes principales: la membrana citoplasmática, el citoplasma y una región nuclear que alberga el material genético. Diferenciación entre células procariotas y eucariotas Existen dos tipos básicos de células según la evolución del mundo biológico y el grado de complejidad en su organización: procariotas y eucariotas Las células procariotas

Figura 29 Esquema de una célula procariota Fuente: diseñado por Carmen Eugenia Piña L.

57

Características 

Carecen de membrana que rodee el material genético el cual se halla más o menos disperso en el citoplasma.  Tienen tamaños comprendidos entre 1 y 10 micrómetros (1 micrómetro equivale a 1/1000mm).  Son células características de seres como las bacterias.  Se dividen por bipartición.  Su citoplasma no posee estructuras membranosas.  Los ribosomas son de menor tamaño.  No poseen citoesqueleto.  Poseen un solo cromosoma. Las células eucarióticas

Figura 30

Características 

Presentan una membrana nuclear que delimita el espacio donde se encuentra el material genético.  Tienen tamaños muy variables que van desde los 10 hasta los 100 micrómetros.  Son células características de los animales, los vegetales, los protistos y los hongos.  Las eucariotas se dividen por división mitótica, por eso tienen centríolos.  Poseen estructuras membranosas como el retículo endoplasmático, y el aparato de Golgi que están ausentes en las procariotas.  Otros orgánelos de importancia capital para las eucariotas son las mitocondrias y los cloroplastos, que faltan en los procariotas.  Los ribosomas son de mayor tamaño.  Presentan citoesqueleto

58

Actividad de Profundización Las células que poseen las siguientes características pertenecen a las células eucarióticas animal; excepto una: A. B. C. D.

desarrollan un proceso de nutrición autótrofo tienen mayor numero de lisosomas dependen de la molécula orgánica que toman del exterior presentan centríolos

Actividad de Transferencia De clic en la siguiente actividad http://www.unad.edu.co/curso_biologia/interactiv_celula.htm y realice la interactividad.

Lección 8 Estructuras y organelos de la célula eucariótica Actividad de Reconocimiento En la siguiente tabla se muestra en la columna de la derecha algunas de las estructuras celulares y en la columna de la izquierda las funciones que desempeñan Seleccione la respuesta que contenga la función correcta para la estructura Estructura A. Mitocondria. B. Membrana Celular C. Citoesqueleto D. Núcleo

A. B. C. D.

Función 1. Crecimiento y reproducción celular 2. Dar forma y sostén a la célula 3. Proteger las células y mantener las condiciones necesarias para el desarrollo de las funciones vitales 4. Extraer la energía de las moléculas alimenticias y almacenarla en forma de ATP

A=1, B=3, C=4, D=2 A=4, B=3, C=2, D=1 A= 3, B=2, C=1, D=4 A=2, B=4, C=1 , D=3

59

Figura 31 Célula eucariótica vegetal Fuente: diseñado por Carmen Eugenia Piña L.

La Membrana Plasmática o CelularEn la superficie de la célula hay una capa citoplasmática muy delgada que forma una envoltura continua: la membrana plasmática que separa la célula de su medio externo. Por una de sus caras, esta membrana se encuentra en contacto con el medio extracelular, por la otra, con el citosol. La membrana citoplasmática está compuesta de lípidos,proteínas e hidratos de carbono en proporciones aproximadas de 40%, 50% y 10%, respectivamente. Según el modelo de membrana "Modelo de mosaico fluido" propuesto en 1972 por J. Singer y G. Nicolson, la membrana está formada por una doble capa lipídica a la que se adosan moléculas proteicas. Si se adosan en ambas caras de la superficie reciben el nombre de proteínas extrínsecas y si, por el contrario, atraviesan la capa de lípidos, reciben el nombre de proteínas intrínsecas o integrales. Los lípidos que forman la membrana son principalmente fosfolípidos, también encontramos cefalinas, lecitinas y colesterol. Los fosfolípidos en contacto con el agua forman una capa doble de moléculas de manera que el extremo hidrofílico o polar (amigo del agua) se dispone hacia el exterior de la célula, es decir, hacia el citoplasma o hacia el líquido extracelular y el extremo hidrofóbico no polar o lipófilo (amigo de los lípidos, repelente al agua) se dispone dentro de la bicapa. El otro componente de la membrana plasmática son los hidratos de carbono: glicoproteínas y glicolípidos según se unan a proteínas o lípidos. Los glicolípidos tienen función estructural. Las glicoproteínas forman el glicocáliz que es una capa densa de carbohidratos que cubre la cara externa de la membrana plasmática y participan en los procesos de endocitosis, en las reacciones antígeno-anticuerpo y en la transducción de señales.

60

Figura 32 Membrana Plasmática http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookCELL2.html#The%20Cell%20Membrane

La estructura de la membrana no es estática y tanto los lípidos como las proteínas tienen gran libertad de movimientos (se comporta como un fluido). La movilidad de los lípidos en el plano de la bicapa que forman, es tanto mayor cuánto más alta es la temperatura ambiente y las cadenas de ácidos grasos estén menos saturadas y sean más cortas. La estabilidad y estructura básica de la membrana se mantiene gracias al colesterol que se une a los fosfolípidos mediante enlaces débiles, manteniendo la estructura de la bicapa Los compuestos proteínicos de la membrana desarrollan las siguientes funciones: 

El transporte selectivo de sustancias (iones, moléculas polares) de un lado a otro de la membrana.  EL control de las reacciones bioquímicas que ocurren en la célula (por enzimas que aceleran o retardan las reacciones químicas)  Actuar como marcadores que identifican a las células para su reconocimiento por otras sustancias u hormonas. Funciones de la membrana celular La membrana mantiene la integridad estructural de la célula, pero además controla la actividad celular, sus funciones básicas son:     

Proteger las células y mantener las condiciones necesarias para el desarrollo de las funciones vitales. Regular los intercambios de sustancias entre el medio exterior e interior. Comunicar a la célula con otras células Mantener la identidad celular Recibir y transmitir información

61

Tipos de transporte a través de la membrana El transporte a través de la membrana ocurre por dos mecanismos transporte activo y transporte pasivo. Transporte pasivoEs un proceso de difusión de sustancias a través de la membrana. No requiere gasto de energía celular, se realiza a favor del gradiente (es decir, de donde hay más hacia donde hay menos) de concentración, de presión o de carga eléctrica. Hay varios mecanismos de transporte pasivo: Difusión simple:si dos sustancias de diferente concentración se encuentran separadas por una membrana semipermeable, las moléculas de la sustancia (soluto) con mayor concentración atraviesan la membrana hacia la solución menos concentrada para igualar las concentraciones de soluto. Ejemplo: El agua, el dióxido de carbono, el oxígeno, moléculas solubles en lípidos como las vitaminas A, E, algunas hormonas esteroideas, atraviesan la membrana de esta forma. Difusión facilitada:es la difusión de moléculas y los iones solubles en agua a través de la membrana, con la participación de las proteínas de la membrana. Las proteínas pueden formar poros o canales con diámetros específicos y cargas eléctricas que permiten el paso selectivo de iones. Los iones de Na+, K+, Ca2+, Cl- atraviesan la membrana de esta manera.Hay canales que permanecen abiertos y otros que solo se abren cuando llega una molécula portadora que se une a las moléculas e induce a una variación de la configura ción que abre el canal, o bien cuando ocurren cambios en la polaridad de la membrana. Es así como la difusión puede ser facilitada por proteínas portadoras que se unen a las moléculas facilitando la apertura del canal y su paso a través de la membrana. Los neurotrasmisores atraviesan la membrana de esta forma. Ósmosis:cuando 2 disoluciones se encuentran separadas por una membrana semipermeable el solvente (agua) pasa a través de la membrana desde la región de mayor concentración de solvente hacia la de menor concentración hasta igualar las concentraciones. La concentración de agua dentro y fuera de las células animales es igual (isotónica), por lo tanto no existe tendencia del agua a entrar o salir de éstas. La ósmosis es clave para la supervivencia de los seres vivos. La absorción de agua y minerales a través de las raíces de las plantas ocurre a través del

62

mecanismo de ósmosis, igualmente la reabsorción de agua y minerales en el riñón. Transporte activo En el proceso de transporte activo también actúan proteínas de membrana, pero éstas requieren energía celular en forma de ATP, para transportar las moléculas al otro lado de la membrana. Se produce cuando el transporte se realiza en contra del gradiente electroquímico. Mecanismo de transporte activo para moléculas de bajo peso molecular Para el transporte de moléculas de bajo peso molecular y en contra del gradiente se requiere la ayuda de las proteínas de transporte denominadas bombas, por su similitud con las bombas de agua. Las proteínas de transporte utilizan energía para mover las moléculas en contra del gradiente de concentración. Son ejemplos de transporte activo la bomba de Na+/K+, y la bomba de Ca.++ . La bomba de Na+/K+ requiere una proteína de transporte que bombea Na+ hacia el exterior de la membrana y K+ hacia el interior. La absorción de minerales en las plantas es un ejemplo de transporte activo Mecanismos de transporte activo para moléculas de elevado peso molecular Existen dos mecanismos principales para el transporte de estas moléculas en contra del gradiente: endocitosis y exocitosis La endocitosis es un proceso de incorporación de sustancias del medio externo a la célula mediante una invaginación en la superficie exterior de la membrana que engloba las partículas o líquidos a ingerir. Una vez las partículas o sustancias dentro de la invaginación se produce la estrangulación de la invaginación originándose una vesícula que encierra el material ingerido el cual es transportado al interior del citoplasma. Según la naturaleza de las partículas englobadas, se distinguen diversos tipos de endocitosis: pinocitosis y fagocitosis. Pinocitosis. Implica la ingestión de líquidos y partículas en disolución a través de una invaginación de la membrana plasmática que forma pequeñas vesículas o vacuolas que luego se introducen al citoplasma con los líquidos ingeridos. La pinocitosis incorpora grandes moléculas como glúcidos, ácidos grasos y aminoácidos, por ejemplo, del quilo alimenticio en las microvellosidades intestinales

63

La fagocitosis implica la incorporación de partículas grandes, o de microorgansimos a través de extensiones de la membrana plasmática, denominadas pseudópodos los cuales engloban las partículas, luego los extremos de los pseudópodos se fusionan dando origen a una vesícula o vacuola alimenticia con las partículas dentro. Las partículas incluidas en la vacuola son digeridas por enzimas digestivas llamadas lisosomas.La fagocitosis la realizan las amebas en su proceso digestivo, los leucocitos para destruir bacterias y las células de microglía del sistema nervioso que destruyen y eliminan las neuronas muertas por heridas o por envejecimiento. ExocitosisLa exocitosis es el proceso contrario a la endocitosis. Tiene como objetivo la excreción de sustancias, ocurre cuando una macromolécula o una partícula debe pasar del interior al exterior de la célula. Las macromoléculas contenidas en vesículas citoplasmáticas creadas por el aparato de Golgi, se desplazan hasta la membrana plasmática, la membrana plasmática y la vesícula se fusionan y la vesícula vierte su contenido al medio extracelular. Productos de desecho de la digestión celular, secreción de hormonas son vertidas hacia el líquido extracelular por este mecanismo. En toda célula existe un equilibrio entre la exocitosis y la endocitosis para que quede asegurado el mantenimiento del volumen celular. Aplicaciones y análisis de casos en el proceso de transporte a través de la membrana Tanto las células animales como vegetales deben vivir en un medio isotónico, (es decir, la concentración del medio en que se encuentra la célula es igual a la concentración del medio interno de la célula) porque de lo contrario se ven afectados por la ley de la ósmosis. Cuando la célula se encuentra en un medio externo con una concentración salina, o proteínica, menor que en su citoplasma o medio interno, diríamos que el medio externo es hipotónico con respecto a ella. La célula reaccionaría buscando el equilibrio, con lo cual, tomará moléculas de agua del medio externo y se hinchará mediante un proceso llamado turgencia, es decir, se hincha hasta que finalmente se puede producir la lisis o rompimiento. Cuando una célula se encuentra en un medio externo que posee una mayor concentración que su medio interno, se dice que es hipertónico con respecto a la célula. En este caso, la célula intentará adaptarse al medio expulsando moléculas de agua de su citoplasma al medio externo. Este fenómeno originaría una deshidratación en la célula llamadoplasmólisis. Es un fenómeno reversible.

64

Ejemplos. Si regáramos una planta con agua de mar, las células de los pelos de las raíces (por donde se capta el agua y las sales minerales), al tratar de buscar el equilibrio entre los medios se deshidrataría, sufrirían una plasmólisis y por consiguiente, morirían. Las hojas de lechuga se ponen turgentes cuando se dejan en agua y luego al aliñar la ensalada se arrugan. Al dejarlas en agua se están colocando en un medio hipotónico, por lo que mediante un proceso osmótico entrará agua al interior de las células de la lechuga, atravesando sus membranas celulares que son semipermeables; se producirá por tanto el proceso de turgencia. Al añadirle la sal del aliño, el medio se convierte en hipertónico y ocurre el proceso inverso: las hojas pierden agua pues ésta se desplaza al medio externo (de mayor concentración salina) por ósmosis, lo que da lugar a que se arruguen las hojas. Los glóbulos rojos normalmente tienen una forma bicóncava y se encuentran suspendidos en un líquido denominado plasma que contiene sales, proteínas y otros solutos. La concentración del interior celular del glóbulo rojo, así como de todas las células de mamífero en general, equivale a una concentración de NaCl de 154 mM. Las soluciones que se administran vía venosa deben ser isotónicas para los eritrocitos en esta situación no hay entrada ni salida neta de agua a los eritrocitos u otras células sanguíneas (equilibrio osmótico). Si se administra a los glóbulos rojos una solución de mayor concentración de solutos, el glóbulo rojo se deshidrata y su volumen disminuye. En este caso los glóbulos rojos sufren un cambio en su morfología discoidal, deformándose debido a que se ha producido la salida de parte del agua de su citoplasma al medio externo debido a la ley osmótica. Esta falta de agua produce un arrugamiento celular y una pérdida de volumen debido al fenómeno de plasmólisis como lo demuestran los arrugamientos de su membrana que deja de estar tersa.

Figura.33Eritrocitos

65

Por el contrario, cuando el glóbulo rojo es colocado en una solución hipotónica o de menor concentración de solutos, como el agua, el agua entra al glóbulo rojo , éste se hincha, se produce lisis o rotura de los glóbulos rojos debido a la entrada de agua del medio externo al interior de la célula, como se observa en laFigura lV Por este motivo cuando se produce una herida resulta conveniente lavarla con suero salino (de igual composición salina que el plasma sanguíneo), resultando perjudicial lavarla con agua destilada. Al lavar un herida (células vivas) con suero salino, no se altera el equilibrio osmótico de las células, por lo que no sufrirán daño; en cambio, si se lava con agua destilada, se las somete a un medio muy hipotónico, por lo que sufrirán una entrada masiva de agua por procesos osmóticos, que las perjudica, pudiendo llegar a destruirlas. Citoplasmaforma un fluido viscoso que circunda el núcleo y está limitado por la membrana plasmática. Se compone básicamente de agua y numerosas sustancias minerales y orgánicas disueltas en solución coloidal. Las sustancias minerales contenidas están ionizadas. Sobre todo hay potasio, sodio, calcio y magnesio, en dosis extremadamente exactas. Las sustancias orgánicas son básicamente proteínas y en menor proporción lípidos, carbohidratos, ácidos nucleicos. En el citoplasma de la célula eucariota encontramos el citoesqueleto, orgánelos como las mitocondrias, los lisosomas, el núcleo, además de un sistema de membranas el retículo endoplasmático, unos gránulos los ribosomas y vacuolas en células vegetales. La función del citoplasma está relacionada con los procesos metabólicos encargados de las síntesis de compuestos como aminoácidos, lípidos, carbohidratos entre otros. El Núcleo

Figura 34 El núcleo Fuente: diseñado por Carmen Eugenia Piña L

El núcleo es el organelo que gobierna todas las funciones de la célula. Las principales funciones son: crecimiento y reproducción celular, almacenamiento y

66

organización de los genes, trasmisión de la información genética.En las células eucariotas está rodeado por una membrana nuclear, mientras que en las procariotas no existe dicha membrana, por lo que el material nuclear está disperso en el citoplasma. En las células eucariotas al núcleo también se le llama carioplasma, se localiza en el centro de la célula y suele tener una forma redondeada o elíptica en las células prismáticas.El núcleo de una célula eucariota puede presentarse en dos formas distintas, según sea la etapa en que se halle la propia célula. En las células que no están en división y consecuentemente su núcleo no está en proceso de transformación, el DNA se encuentra combinado con proteínas como las histonas, dándole una apariencia fibrilar. Esta combinación de DNA y proteínas se llama cromatina. Durante la división celular o mitosis la cromatina se condensa en cromosomas susceptibles de ser coloreados y observados al microscopio óptico. Los cromosomas tienen como función portar los factores hereditarios o genes y trasmitir la información genética de una célula a otra sin modificarla ni empobrecerla, esta transmisión ocurre durante la división de la célula.No se conoce todavía de modo exacto la estructura de cada cromosoma, pero se supone que cada uno de ellos consta de una o varias dobles hélices de ADN, varias veces envueltas sobre sí mismas. El número de cromosomas de cada célula es constante para cada especie, pero se reduce a la mitad en las células sexuales o gametos. A raíz de este fenómeno, estas células se denominan haploides, frente a la denominación de diploides que tienen las demás células. Cromatina y Cromosomas

Figura 35 El Cromosoma. Fuente: diseñado por Carmen Eugenia Piña L

La cromatina que se puede observar durante la interfase a través del microscopio electrónico como filamentos muy delgados y retorcidos está constituida por ADN,

67

proteínas y ácidos nucleicos; pero cuando la célula entra en división la cromatina se organiza en estructuras individuales que son los cromosomas Un cromosoma es una molécula de ADN muy larga que contiene una serie de genes. Un cromosoma está formado por dos cromátidas. En cada una de ellas hay un nucleofilamento de ADN replegado e idéntico en ambas cromátidas. Las cromátidas están unidas a través del centrómero. En las cromátidas también se observa un cinetócoro que es el centro organizador de microtúbulos que se forman durante la mitosis y que ayudan a unir los cromosomas con el huso mitótico. El Nucleolo Se encuentra dentro del núcleo de células eucarióticas aparentemente sin membrana delimitadora y asociado con una región específica de un cromosoma llamado organizador nuclear, que al parecer atraviesa al nucleolo.Cuando la célula eucariota permanece sin dividirse (período de interfase), el nucleolo se puede observar al microscopio óptico como un organelo de color más oscuro, de tamaño pequeño (1 a 7 micrómetros) y de forma redondeada. El nucleolo está compuesto por de proteína, ARN y ADN. El tamaño y la morfología de los nucleolos varía en función de la especie, del tipo celular y del estado fisiológico de la célula. Es así como su número y tamaño aumentan durante la síntesis de proteínas. Durante la división celular el nucleolo desaparece. La función del nucleolo es la síntesis de ribosomas.En las células procariotas el nucleolo está ausente. El Retículo Endoplasmático

Figura 36 Retículo endoplasmático Fuente: diseñado por Carmen Eugenia Piña L

Se encuentra en todas las células eucariotas y ocupa hasta el 10% del espacio interior de éstas. Se trata de un sistema de membranas cuyas dimensiones

68

dependen del estado fisiológico de la célula: es más reducido en las células poco activas o poco diferenciadas. El retículo endoplasmático forma una red de pequeños canales múltiples, comunicantes entre sí, que atraviesan el citoplasma y van desde la membrana nuclear hasta la membrana plasmática. Su función consiste en transportar materiales dentro de la célula a manera de un sistema circulatorio. En puntos diversos forma pequeñas cavidades o vesículas, y está constituido por una doble lámina que limita dos espacios: el citoplasmático y el reticular. El espacio que queda limitado en el interior se denomina lumen. La membrana externa puede ser rugosa, con la presencia de ribosomas y se denomina retículo endoplasmático rugoso, o lisa carente de ribosomas y en este caso se denomina retículo endoplasmático liso.El retículo endoplasmático liso es responsable de: la síntesis de fosfolípidos y colesterol y el procesamiento de sustancias tóxicas procedentes del exterior de la célula.La actividad del retículo endoplasmático rugoso está estrechamente relacionada con la síntesis de proteínas y viene determinada por la presencia de ribosomas. Ribosomas Son organelos compactos y globulares, se encuentran tanto en las células procariotas como en las eucariotas. Están compuestos por ARN y proteínas. Son unos gránulos cuyas dimensiones se miden en millonésimas de milímetro, se hallan situados sobre las membranas del retículo endoplasmático rugoso o sobre la cara externa de la membrana nuclear, o incluso aislados en el plasma.

Figura 37 Ribosoma Fuente: diseñado por Carmen Eugenia Piña L

En los ribosomas tiene lugar la síntesis de proteínas, es decir, la unión de los aminoácidos de una proteína siguiendo una secuencia establecida genéticamente. Mitocondrias Son minúsculos orgánelos celulares, se hallan, generalmente en gran número, en

69

casi todas las células vegetales y animales (células eucariotas). Las mitocondrias Suelen tener forma de saco tubular, ovalado. Observadas al microscopio electrónico presentan dos membranas separadas

Figura 38 Mitocondria Fuente: diseñado por Carmen Eugenia Piña L

La membrana interna presenta crestas o repliegues hacia el interior que aumentan la superficie de la membrana. Contiene numerosas proteínas de transporte y otras con funciones muy especializadas, como los complejos que forman la cadena respiratoria y el ATP (trifosfato de adenosina) La membrana externa. Contiene numerosas proteínas que regulan los intercambios de sustancias con el citosol (parte líquida del ciptoplasma). Se destacan las proteínas de canal, las cuales forman grandes poros que la hacen muy permeable. Las mitocondrias se constituyen en fábricas de energía celular; ellas extraen la energía de las moléculas alimenticias y la almacenan en forma de ATP, dicha energía es utilizada en todos los procesos metabólicos, ésto se lleva a cabo a través de la respiración celular.El proceso de oxidación de alimentos se constituye en la respiración celular aerobia, y consiste en una serie de reacciones catalizadas enzimáticamente y tiene como propósito la producción de energía biológicamente útil ATP en células que viven en presencia de oxígeno. En este proceso, se transfieren electrones desde la glucosa (molécula proveniente del alimento) hasta el oxígeno molecular para producir energía, bióxido de carbono y agua Glucosa + 6O2 CO2 + 6H2O + 36 ATP

Aparato de GolgiEs un organelo común a todas las células eucariotas y está especialmente desarrollado en aquellas que tienen actividad secretora.

70

Figura 39 Aparato de Golgi Fuente: diseñado por Carmen Eugenia Piña L

El aparato de Golgi se deriva del retículo endoplasmático y está constituido por una serie de cavidades planas paralelas, delimitadas por una membrana, en cuya periferia hay unas vesículas llamadas asimismo de Golgi. La función del aparato de Golgi consiste en: 

El aislamiento dentro del citoplasma y mediante una membrana, de algunas sustancias (por ejemplo separa proteínas, de lípidos)  Empacar esas sustancias en las vesículas con el fin de llevarlas al interior del propio citoplasma o a su parte exterior.  Intervenir en los procesos de secreción y la excreción celular  Proteger a la célula de la acción tóxica de determinadas sustancias.  Intervenir en la formación de los lisosomas

Vacuolas Las vacuolas son organelos abundantes en las células vegetales y bastante escasos y muy pequeños en las células animales. Están rodeadas de una membrana denominada tonoplasto y en su interior se encuentra una sustancia fluida de composición variable. Las vacuolas pueden ocupar entre un 5 y un 90% del volumen celular, aunque, de hecho, casi siempre es superior al 30%. Desempeñan funciones muy diversas, hasta el punto de que en una misma célula pueden encontrarse vacuolas con funciones distintas. En las células vegetales las vacuolas intervienen en los siguientes procesos: 

Constituyen reservas de sustancias nutritivas (azúcares, grasas), que están a disposición de las necesidades de la célula.  Actúan como almacenes de productos tóxicos para la célula.  Dan soporte a la célula.  Contribuyen al crecimiento de los tejidos.  En organismos unicelulares sirven para realizar el proceso digestivo. Eliminan el exceso de agua que entra a la célula.

71

Lisosomas Loslisosomas son organelos característicos de las células eucariotas. Son más abundantes en células animales. Son pequeñas vesículas de forma y tamaño variables, aunque, por lo general, son esféricas. Los lisosomas están limitados por una membrana y en su interior, contienen enzimas como lipasas y nucleasas. Los lisosomas se encargan de: 

La hidrólisis de macromoléculas. Esas macromoléculas pueden proceder del exterior de la célula por endocitosis, como las sustancias nutritivas que deben digerirse.  Digerir organelos de la propia célula defectuosos, que no funcionan bien o que envejecen  Destruir microorganismos como virus o bacterias nocivos para la célula. Peroxisomas Están presentes en las células eucariotas y pueden encontrarse dispersos por el citoplasma o bien estrechamente relacionados con otros organelos como mitocondrias o cloroplastos.Son organelos pequeños y esféricos, rodeados por una membrana, contienen: enzimas oxidasas y catalasas. Las funciones de los peroxisomas son: 

Llevar a cabo reacciones oxidativas de degradación de ácidos grasos y aminoácidos por acción de las oxidasas. Es así como, las oxidasas utilizan el oxígeno molecular para eliminar átomos de hidrógeno de los sustratos. Como resultado de esta oxidación en unos casos se obtiene agua y en otros peróxido de hidrógeno.  Degradar el peróxido de hidrógeno sustancia que es muy tóxica para la célula, por acción de la enzima catalasa, con la producción de agua y oxígeno.  Intervenir en reacciones de detoxificación (por ejemplo, gran parte del etanol que bebemos es detoxificado por peroxisomas de células hepáticas) Centrosomas y Centríolos Los centrosomas están constituidos por un par de centriolos presentes en células animales. Su función principal es formar las fibras del huso acromático en el proceso de división celular

72

Figura 40 Centriolos y centrosomas

Los centriolos se encuentran en número par, son muy pequeños y de difícil observación en el período de interfase. Observado con el microscopio electrónico, cada centriolo aparece como un cilindro hueco, con un diámetro de 0,15 micras y una longitud de 0,5 micras. La pared del centriolo está constituida por una serie de agrupamientos de túbulos.Los centriolos se hacen visibles durante la división celular, cuando desempeñan su función principal consistente en la producción del huso mitótico. Forman también los cilios y flagelos de las células. Plastos o Plastidios Los plastos se encuentran exclusivamente en las células vegetales, tienen forma de disco o esférica limitados por una membrana doble. Se agrupan en tres tipos: cloroplastos, leucoplastos y cromoplastos.

Figura 41 El cloroplasto. Fuente: diseñado por Carmen Eugenia Piña L

Loscloroplastos son característicos en vegetales y en algunas algas unicelulares. Están rodeados por una membrana doble: la externa que presenta plegamientos o crestas y es muy permeable, y la interna lisa, es decir sin crestas, menos permeable que la externa y con numerosas proteínas especializadas en el transporte selectivo de sustancias. La membrana interna contiene un semifluido denominado estroma compuesto de enzimas, ADN y ribosomas. Dentro del estroma se localizan unos sáculos aplanados y membranosos, a los cuales en forma individual se les llama tilacoides y contienen el pigmento verde o clorofila, así como otros pigmentos. Los tilacoides tienden a formar apilamientos denominados grana, los cuales se conectan entre sí formando una red de cavidades.

73

Los cloroplastos tienen como función realizar la fotosíntesis. Leucoplastos:son estructuras incoloras o blancas que almacenan almidón, grasa, proteínas y otras sustancias. Cromoplastos: Dan color a las flores, la cáscara y la pulpa de muchos frutos y son organelos con pigmentos de diferentes colores, excepto el verde. Citoesqueleto Presente en células eucariotas está compuesto por una red de fibras protéicas en forma de microfilamentos, filamentos y microtúbulos gruesos. Las funciones del citoesqueleto son:  

Dar forma y sostén a la célula. Facilitar el movimiento celular ameboideo y de migración por acción del deslizamiento y ensamblado y desamblado de los microfilamentos y microtúbulos.  Ayudar al sostén, posición y movimiento de organelos. Participar en la división celular al mover los cromosomas hacia las células hijas y al contraer el citoplasma para su división. Pared Celular Presente en las células eucariotas vegetales y fúngicas, externa a la membrana plasmática. Básicamente está compuesta de celulosa, y en menor cantidad de otras sustancias como la hemicelulosa, los pectatos o pectinas, lignina, suberina, cutina, proteínas, sales minerales y ceras. La pared celular cumple un papel importante en la absorción, transpiración, secreción y traslocación. Sirve de protección contra la desecación y de defensa contra bacterias y otros patógenos Diferencias entre la célula eucariota vegetal y animal La célula eucariota vegetal   

Utiliza la materia inorgánica para sintetizar compuestos orgánicos. Aprovecha la energía lumínica para que tenga lugar el proceso anterior. Utiliza después la energía química de las moléculas orgánicas que ella ha sintetizado.  Desarrolla un proceso de nutrición autótrofa.  Presenta pared celular.  Contiene plastos.  Tiene mayor número de vacuolas

74

La célula eucariota animal      

No puede sintetizar moléculas orgánicas a partir de moléculas inorgánicas. No aprovecha la energía lumínica en la síntesis de moléculas orgánicas. Depende de las moléculas orgánicas que toma del exterior y de la energía química que estas contienen. Desarrolla un proceso de nutrición heterótrofa. Tiene mayor número de lisosomas. Presenta centríolos.

ACTIVIDAD DE PROFUNDIZACIÓN Situación de salida/ Metas para competencia: El estudiante identifica, describe y analiza con propiedad las características de los seres vivos, su estructura, función y diversidad. Aspectos Situación didáctica procedimentales Situación Actividades de entrada: Producto Tiempo previsto de desarrollo: 6 h Carácter de la actividad: individual grupo colaborativo máximo de 3 personas Sistema de interactividades: Acompañamiento Tutorial en Grupo de curso asincrónica 1h Recurso tecnológico : aula virtual o materiales impresos Formato de objetivación/ productos: Informe con mapa conceptual Sistema de evaluación: SumativaHeteroevaluación. PDP Seguimiento: PDP por parte del tutor

º Elabore un mapa conceptual socialícelo en pequeño grupo colaborativo a través del aula Virtual y luego incorpore ajustes basados en la realimentación resultante de la socialización. En su ejercicio deben aparecer los siguientes conceptos que se encuentran sin orden jerárquico y que usted debe reordenar y organizar jerárquicamente agregando las palabras enlace y los conectores: funciones de la célula, sistemas de comunicación, sexual, relación, autótrofa, ADN lineal , asexual, nutrición, respiración, reproducción, mitosis, exocitosis, digestión, movimiento, energía, heterótrofa, fotosíntesis, mitocondrias, crecimiento, procariota, endocitosis, respuestas, transporte de membrana, pinocitosis, meiosis, absorción, eucariota, estructuras membranosas, citoesqueleto, ribosoma, membrana nuclear, ADN de cadena doble circular Los resultados de la actividad se incorporarán en su PDP y se publicarán

° Mapa conceptual en Portafolio de desarrollo personal y enviado al tutor y socializado en el aula Virtual.

75 en el aula Virtual para socialización y realimentación con el tutor y demás compañeros.

Actividad de Transferencia Las hojas de lechuga se ponen turgentes cuando se dejan en agua y luego al añadir sal a la ensalada estas se arrugan. Este proceso se debe a que el agua es un medio hipotónico con relación a la savia de la lechuga por lo cual mediante el proceso de:

a. Osmosis, entra agua al interior de las células de la lechuga para igualar concentraciones con la consecuente turgencia de las hojas, al añadirle la sal del aliño, el medio se convierte en hipertónico y ocurre el proceso inverso: las hojas pierden agua pues esta se desplaza al medio externo, lo que da lugar a su plasmolisis. b. Difusión simple, entra agua al interior de las células de la lechuga para igualar concentraciones con la consecuente turgencia de las hojas, al añadirle la sal del aliño, el medio se convierte en hipertónico y ocurre el proceso inverso: las hojas pierden agua pues esta se desplaza al medio externo, lo que da lugar a su plasmólisis. c. Osmosis, sale agua del interior de las células de la lechuga para igualar concentraciones con la consecuente turgencia de las hojas, al añadirle la sal del aliño, el medio se convierte en hipertónico y ocurre el proceso inverso las hojas pierden agua pues esta se desplaza al medio externo. d.Difusión facilitada, sale agua del interior de las células de la lechuga para igualar concentraciones con la consecuente turgencia de las hojas, al añadirle la sal del aliño, el medio se convierte en hipertónico y ocurre el proceso inverso las hojas pierden agua pues esta se desplaza al medio externo

Lección 9Procesos Celulares Actividad de Reconocimiento El conjunto de reacciones químicas que ocurren al interior de las células y que le permite a los seres vivos desarrollar sus actividades vitales . Se conoce como a. Homeostasis b. Metabolismo

76

c. Nutrición d. Respiración º NutriciónConsiste en la captación de materia para crecer, reponer las partes de la célula que estén envejecidas y disponer de materias primas para las distintas actividades celulares y obtener la energía. Todos estos procesos se realizan mediante reacciones bioquímicas. º Metabolismo Es el conjunto de reacciones que se producen dentro de las células de los seres vivos, estas reacciones son catalizadas por enzimas concretas. Hay dos grupos de reacciones metabólicas:Anabolismo (síntesis)Es el conjunto de reacciones cuyo objetivo es la obtención de moléculas complejas y ricas en energía (glúcidos, ácidos grasos) a partir de moléculas simples. Estas reacciones consumen energía que se incorpora a la molécula sintetizadadora, son reacciones endergónicas.Catabolismo (degradación)El conjunto de transformaciones bioquímicas que las células realizan a partir de moléculas energéticamente ricas. Se produce energía química disponible para otras reacciones y se obtienen productos más simples. Son reacciones exergónicas. La materia y la energía que proporciona la nutrición ponen en marcha todas las reacciones metabólicas, el proceso comienza con la entrada de nutrientes del exterior.  Respiración celular Es una oxidación de moléculas orgánicas para suministrar energía a plantas y animales. La energía obtenida se utiliza para unir un grupo de fosfatos de alta energía ADP y formar un portador de energía a corto plazo el ATP. En las células vegetales la respiración se realiza a partir de la glucosa obtenida en la fotosíntesis. En las animales, se realiza a partir de la glucosa obtenida al ingerir los alimentos. La respiración necesita:    

Monómeros de la grandes biomoléculas (glucosa). Moléculas transportadoras de electrones. Molécula receptora que es el oxígeno. Un espacio cerrado para que se lleve acabo la transferencia de electrones, este espacio es la mitocondria. Hay dos tipos de respiración: respiración aeróbica y respiración anaeróbica. Respiración Aeróbica El oxígeno libre se utiliza para oxidar moléculas orgánicas y convertirlas en bióxido de carbono y agua con alta liberación de energía. Respiración AnaeróbicaRespiración propia de levaduras, algunas bacterias anaerobias, y ocasionalmente presente en los tejidos cuando no interviene el

77

oxígeno. El sustrato orgánico no está totalmente oxidado y la producción de energía es baja al convertirse la glucosa de los tejidos musculares en ácido pirúvico por glucólisisy también en ácido láctico, que luego puede oxidarse cuando vuelve la presencia de oxígeno.  La fotosíntesis es el paso previo de los seres autótrofos para obtener la materia que utilizará en procesos posteriores. Su objetivo es obtener moléculas orgánicas (glúcidos) a partir de moléculas inorgánicas. Para que esto ocurra se necesita:   

Luz Cloroplasto con pigmentos: cLección lorofila. Moléculas transportadoras y receptoras de electrones

Sucede: 

Al incidir la luz en la clorofila, se produce el desprendimiento de electrones activados.  Las moléculas transportadoras de electrones los llevan hacia el aceptor final.  En el espacio cerrado del cloroplasto se intercambian los electrones sin dispersarse.  La eficacia es máxima. Fase dependiente de la luz El cloroplasto capta la energía lumínica que se invierte en:   

Activar la clorofila para que se desprendan electrones. Romper moléculas de agua. Formar moléculas de ATP que contienen en sus enlaces la energía química procedente de los electrones activados.

Fase independiente de la luz.  



No requiere presencia de luz. Se llama también fase de fijación del carbono porque se capta CO2 atmosférico, que se incorpora para formar glucosa, proceso que permitirá producir almidón. Los glúcidos (glucosa, almidón) obtenidos se utilizarán también en la síntesis de otro tipo de biomoléculas como los aminoácidos, los lípidos y los nucleótidos.

78 

Relación Consiste en captar las condiciones del ambiente y elaborar las respuestas más indicadas para sobrevivir en cada caso.

Las células deben presentar sensibilidad respecto a ciertos estímulos como son: la luz, las sustancias químicas, el contacto con otros elementos. Las reacciones frente a estos estímulos son respuestas.Ejemplo: el movimiento de corrientes citoplasmáticas que provocan que la célula se pueda desplazar.Estos desplazamientos se realizan mediante: seudópodos, cilios y flagelos. Los seudópodos: son prolongaciones del citoplasma que arrastran y desplazan la célula. Este movimiento característico de amebas y leucocitos se conoce como ameboide. Se origina por variaciones de la viscosidad del citoplasma al pasar del estado de sol al de gel, o por una disminución de la tensión superficial. Cilios y flagelos: son tubos redondeados, que salen desde la membrana plasmática y se prolongan fuera de la célula. Su movimiento es vibrátil. Los cilios son pequeños y numerosos y el desplazamiento se produce por movimientos bruscos como látigos.Los flagelos son de mayor tamaño, su cantidad es menor (puede haber solo uno) y su movimiento es suave. Otro tipo de respuesta ante condiciones ambientales muy desfavorables, es el de algunas células que producen esporas (estructuras muy resistentes) las cuales engloban una parte del citoplasma y el cromosoma para protegerlo y conservarlo. Las esporas pueden resistir mucho tiempo y cuando las condiciones mejoran, las esporas absorben agua, activan su metabolismo y la célula se reproduce. Otros procesos celulares fundamentales son los de división celular: mitosis y meiosis, los cuales por su importancia se tratan por separado.

Actividad de Profundización El metabolismo se divide en dos procesos contrarios y relacionados entre si (conjugados): catabolismo y anabolismo. Un ejemplo de catabolismo es la glucólisis, mediante el cual la glucosa por reacciones enzimáticas se convierte en dos moléculas de piruvato, capaces de seguir otras vías metabólicas y así entregar energía al organismo. Según la anterior información podemos decir que el anabolismo: A. Es la transformación de moléculas orgánicas complejas en moléculas sencillas con requerimiento de energía B. Permite sintetizar moléculas orgánicas a partir de moléculas sencillas con requerimiento de energía C. Permite sintetizar moléculas orgánicas a partir de moléculas sencillas con liberación de energía

79

D. Es la transformación de moléculas orgánicas complejas en moléculas sencillas con liberación de energía

Unidad 1: Estructura, función y diversidad de los seres vivos FASE DETRANSFERENCIA Situación de salida/ Metas para competencia: Meta: El estudiante identifica, describe y analiza con propiedad las características de los seres vivos, su estructura, función y diversidad. Aspectos procedimentales Situación

Situación didáctica Actividades de entrada:

Tiempo previsto de desarrollo: 6.0 h

Elabore una tabla comparativa para los procesos de fotosíntesis y respiración aeróbica teniendo en cuenta los Carácter de la actividad siguientes criterios para cada uno de los procesos: : individual 2.0 h Sistema de interactividades: Tutorial individual asincrónica

Fotosíntesis

Respiración

º En qué organelo se realiza? º En qué tipo de células se realiza º En qué tejidos se lleva acabo? º Qué tipo de organismos la realizan? Formato de bjetivación/ º Qué se consume? productos: Informe º Qué se libera? º Cuáles son los productos finales? Sistema de evaluación: º Escriba las reacciones químicas formativa, sumativa PDP ° Qué condiciones se necesitan para realizar el proceso? Seguimiento: PDP por º Cuál es la utilidad del proceso? parte del tutor y º Cuál es su importancia biológica? sistematización enviada al director nacional para Incorpore a su portafolio observaciones seguimiento y pertinentes que le hayan aportado en realimentación PDG Recurso tecnológico: Aula virtual

Producto: ° Informe en PDP para seguimiento tutorial enviados al tutor, y socializadas en el aula Virtual

80

Lección 10. División celular Fase de Reconocimiento Situación de salida/ Metas para competencia: Meta: El estudiante identifica los mecanismos de herencia. Aspectos procedimentales Situación 4

Situaciones didácticas Actividades de entrada:

Productos:

Tiempo previsto de desarrollo: 3 horas

° Informe con ° Sin consultar en fuentes documentales realice lo siguiente: listas

Actividad: individual 2h

1. Organice una lista descendente donde el elemento de arriba contenga al que este inmediatamente debajo, seleccionando entre los siguientes componentes: alelo, ADN, nucleótido, gen, cromosoma, núcleo, y consígnelos en PDP para seguimiento tutorial.

Sistema de interactividades: Pequeño grupo colaborativo Recurso tecnológico: Aula Virtual Formato de objetivación/ productos: listas organizadas Sistema de evaluación: Formativa: autoevaluación y Coevaluación

organizadas que debe ubicar en el PDP

2. Ordene en orden secuencial las siguientes fases del proceso de meiosis. Metafase I, profase I, Telofase I, diacinesis, anafase I.

Realizado el ejercicio confronte Seguimiento: Autorregulación (no necesita fuentes documentales y analice su enviar al tutor ni a la dirección nivel de acierto. nacional) Según el tercer principio de la teoría celular, las células se originan a partir de otras células; este proceso se denomina división celular.La división celular puede ocurrir por mitosis en las células somáticas (las que forman el cuerpo) y tienen dos juegos de cromosomas (2n) o por meiosis en las células germinativas que originan los gametos (óvulo y espermatozoide) con número haploide (n) de cromosomas.

81

La división mitótica permite que de una célula madre se originen dos nuevas células hijas, con las mismas características morfológicas y fisiológicas de la célula preexistente.El objetivo de la división mitótica es conseguir la duplicación de la célula de modo que las dos células hijas reciban la dotación cromosómica idéntica a la de sus progenitores. En los organismos unicelulares la división mitótica da origen a un nuevo organismo. En los organismos multicelulares las células somáticas diploides se reproducen para formar tejidos, órganos, para reemplazar las partes envejecidas, desgastadas, muertas y para permitir el crecimiento del organismo.Las etapas a través de las cuales pasa una célula de una división celular a otra constituyen el ciclo de la célula.La duración y las características del ciclo celular son variables y dependen del tipo de célula y de las circunstancias en que se desarrolla. El Ciclo celular se divide en dos fases principales:  

La interfase período durante el cual los cromosomas se duplican y La mitosis fase en la cual los cromosomas duplicados se reparten en dos núcleos Al final de la mitosis ocurre la citocinesis cuando la célula se divide originando dos células hijas. InterfaseLa mayor parte del tiempo del ciclo celular transcurre en la etapa de interfase durante la cual la célula duplica su tamaño y el contenido cromosómico, la interfase puede durar horas, días o semanas según el tipo de célula.

Interfase en célula de cebolla

Interfase en célula animal

Figura 42Ilustraciones comparativas de interfase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.

En la etapa de interfase la célula está ocupada en la actividad metabólica preparándose para la mitosis. Los cromosomas no se observan fácilmente en el núcleo, mientras que el nucleolo puede ser visible como una mancha oscura .Durante la interfase se sintetiza el ARN mensajero y ribosomal; se replica el ADN;

82

la célula animal puede contener un par de centríolos los cuales forman el huso acromático. MitosisAunque la mitosis es un proceso dinámico, secuencial y continuo por razones prácticas para facilitar el análisis y la experimentación se divide en cuatro fases o etapas: profase, metafase, anafase y telofase.Durante la mitosis hay variación en el núcleo de la célula, los cromosomas duplicados se separan y se producen dos núcleos cada uno con una copia fiel de cada cromosoma. La mitosis a menudo se acompaña de citocinesis, proceso durante el cual la célula divide su citoplasma produciendo dos células hijas con iguales organelos. La fase mitótica (mitosis y citocinesis) generalmente dura 30 minutos. ProfaseLa célula parece más esférica y el citoplasma más viscoso. Al comienzo de la profase los cordones de cromatina se enrollan lentamente y se condensan, aparecen los cromosomas.

Profase en célula de cebolla

Profase en célula animal

Figura 43 Ilustraciones comparativas de profase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.

En esta fase los cromosomas están agrupados por parejas llamándose a cada uno de los dos que conforman el par, cromosoma homólogo (tienen igual longitud, igual posición del centrómero e iguales genes), y cada cromosoma del par está a su vez constituido por dos cromátidas unidas por el centrómero.En las células de la mayoría de los organismos, exceptuando las plantas superiores se ven dos pares de centríolos a un lado del núcleo, fuera de la envoltura nuclear. Durante la profase los pares de centríolos empiezan a alejarse el uno del otro, y a medida que éstos se separan aparecen entre ambos pares de centríolos las fibras del huso acromático, consistentes en microtúbulos y otras proteínas. Los nucléolos dejan de ser visibles. La envoltura nuclear se disgrega. Al terminar la profase, los cromosomas se han condensado por completo, los pares de centríolos están en extremos opuestos de la célula. El huso se ha formado por completo. MetafaseEn etapa de metafase cada cromosoma se une a dos fibras del huso, provenientes cada una de un polo, y se alinean en el plano ecuatorial, es decir, en el centro de la célula

83

Metafase en célula de cebolla

Metafase en célula animal

Figura 44Ilustraciones comparativas de metafase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educationa l, non-profit endeavors without permission.

Anafase

Anafase en célula de cebolla

Anafase en célula animal

Figura 45Ilustraciones comparativas de anafase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.

Mientras se ha ido formando el huso acromático, los cromosomas se han dividido en dos mitades o cromátidas, las dos cromátidas se separan, arrastradas por los filamentos tractores del huso acromático y se dirigen a los dos polos de la célula, convertidos ya en cromosomas hijos. TelofaseLos cromosomas se sitúan en cada polo, las fibras del huso se dispersan por el citoplasma, se inicia la formación de las envolturas nucleares que rodearán a los dos núcleos hijos. Los cromosomas se tornan difusos, pues se empiezan a desenrollar. Aparece un nucleolo en cada polo, se inicia la citocinesis (división del citoplasma por la mitad), se forman dos células hijas.

84

Telofase en célula de cebolla

Telofase en célula animal

Figura 46 Ilustraciones comparativas de telofase Tomadas de http://biology.nebrwesleyan.edu/benham/mitosis/index.html All images are copyrighted 2001 by Dale M. Benham. However these images may be used for educational, non-profit endeavors without permission.

CitocinesisEtapa de la división celular que consiste en la división del citoplasma. El proceso visible de la citocinesis suele empezar en la telofase de la mitosis y por lo general divide la célula en dos partes más o menos iguales. La citocinesis difiere en ciertos aspectos en células animales y vegetales. En las células animales, durante la telofase, la membrana celular empieza a estrecharse en la zona donde estaba el ecuador del huso. Al principio se forma en la superficie una depresión, que poco a poco se va profundizando para convertirse en un surco hasta que la conexión entre las células hijas queda reducida a un hilo fino, que no tarda en romperse para así separar las dos células hijas. En las células vegetales, este proceso es un tanto diferente, puesto que estas células presentan externamente a la membrana plasmática, una pared bastante rígida. En este caso, la citocinesis se produce por la formación de un tabique entre los dos nuevos núcleos, este tabique va creciendo desde el centro hacia la periferia de la célula, hasta que sus membranas hacen contacto con la membrana plasmática, con la que posteriormente se fusionan completándose la división celular. Meiosis I La meiosis se realiza siempre en las células sexuales o gametos, a diferencia de la mitosis que se realiza en las células somáticas.Las células sexuales o gametos a diferencia de las células somáticas que contienen doble juego de cromosomas, sólo contienen un juego de cromosomas (n) o número haploide. La meiosis es la división celular por la cual se obtienen cuatro células hijas (gametos) con la mitad de los juegos cromosómicos que tenía la célula madre o germinativa, conservando toda la información genética de los progenitores.

85

El proceso de meiosis ocurre en dos fases meiosis l meiosis II, cada una de las cuales consta de las mismas etapas que la mitosis con algunas diferencias en la profase I.En la célula germinativa existen dos juegos de cromosomas o material genético, uno de origen paterno y otro de origen materno. En la Profase I, cada par de cromosomas se aparea con su homólogo, formando lo que se denomina una tétrada, es decir cuatro cromátidas y dos centrómeros. Este apareamiento es una característica propia de la meiosis y tiene importancia porque ocurre el entrecruzamiento de cromátidas (no hermanas) de origen materno y paterno o recombinación genética que permite la variabilidad La meiosis ocurre mediante dos mitosis consecutivas:La primera división de la célula germinativa es reduccional y el resultado es la formación de dos células hijas cada una con un número "n" cromosomas. La segunda división es una división mitótica normal al final se obtienen cuatro gametos haploides a partir de la célula madre diploide. Interfase

Figura 47Célula animal en Interfase en meiosis I Fuente: diseñado por Carmen Eugenia Piña L

La célula sexual se prepara para la división hay replicación del ADN. En las células animales se pueden observar dos centrosomas cada uno conteniendo un par de centríolos. Desde los centrosomas se extienden los microtúbulos que son sitios de formación del huso acromático. En las células vegetales no hay centrosomas. Profase I Es la fase más larga y compleja de la meiosis. Durante la profase I se presenta compactación y acortamiento de los cromosomas, los cromosomas homólogos duplicados durante la interfase, se disponen uno al lado del otro.Ocurre un proceso de apareamiento para formar parejas (diploides = 2n) o pares de cromosomas, un par materno y el otro par paterno.

86

Figura 48 Fuente: diseñado por Carmen Eugenia Piña L

Figura 49Profase I b

Fuente: diseñado por Carmen Eugenia Piña L

Ambos pares de cromosomas llevan el mismo tipo de genes y codifican un mismo tipo de información, aunque en uno de los alelos ésta puede ser de carácter dominante y en el otro puede ser recesiva. Ejemplo un alelo A dominante para la información color de los ojos en el par cromosómico paterno y un alelo a recesivo para la misma información en el par cromosómico materno. A través del microscopio se puede observar cada cromosoma formado por dos cromátidas y un centrómero.

Figura 50Esquema con representación de cromosomas con alelos para un carácter Fuente: diseñado por Carmen Eugenia Piña L

Figura 51Esquema con representación de entrecruzamiento de cromosomas no hermanos Fuente: diseñado por Carmen Eugenia Piña L

87

Las cromátidas no hermanas (una procedente del padre y otra de la madre) se enrollan una alrededor de la otra, formando una región denominada quiasma en donde se puede presentar entrecruzamiento de cromosomas homólogos. Durante el entrecruzamiento un fragmento de una cromátida puede separarse e intercambiarse por otro fragmento de su correspondiente homólogo, con el consecuente intercambio de genes.Esta recombinación genética entre los cromosomas, permite la variabilidad y de esta manera mejorar las características de la descendencia.Este apareamiento que se realiza a lo largo del cromosoma, alelo por alelo, en toda su extensión, se denomina sinapsis.

Figura 52Esquema con Figura 53 profase I c Formación de tétradas en representación de cromosomas la profase l no hermanos en sinapsis Fuente: diseñados por Carmen Eugenia Piña L

El resultado del proceso de sinapsis son las tétradas o pares bivalentes, es decir que cada par de cromosomas está formados por 4 cromátidas y dos centrómeros. Al final de la profase I el nucleolo y la membrana nuclear han desaparecido y en el citoplasma se forma el huso acromático. Metafase l

Figura 54metafase I Fuente: diseñado por Carmen Eugenia Piña L

88

Desaparecen la membrana nuclear y el nucleolo. Las tétradas se alinean en el plano ecuatorial. La alineación es al azar. Esto quiere decir que hay un 50% de posibilidad de que las células hijas reciban el homólogo del padre o de la madre por cada cromosoma.

Figura 55anafase I a anafase Ib Fuente: diseñados por Carmen Eugenia Piña L

Anafase lLas tétradas se separan y los cromosomas se desplazan hacia los polos opuestos, el huso acromático desaparece, se forman cromosomas hijos haploides con dos cromátidas cada uno. Telofase I y Citocinesis I

Figura 56Telofase I

Figura 57Citocinesis I

Figura Citocinesis I

Fuente diseñado por Carmen Eugenia Piña

Ocurre la primera división meiótica. Se forman núcleos hijos alrededor de los cromosomas que se encuentran en los polos, el citoplasma se divide en dos (citocinesis) para formar las dos células hijas con número haploide de cromosomas

89

MeiosisIICada célula resultante de la primera división realizará la segunda división meiótica. El número de cromosomas es haploide y la cromatina de cada cromosoma sufrió recombinación genética. IntercinesisLa fase de intercinesis o preparación de la célula es muy rápida. No hay duplicación del ADN por lo tanto no hay duplicación de cromosomas. Profase II

Figuras 58profase II Fuente: diseñados por Carmen Eugenia Piña L

Empiezan a desaparecer la membrana nuclear y el nucleolo, se vuelve a formar el huso acromático, los cromosomas se condensan más, y su número es haploide. Metafase IILa membrana nuclear y el nucleolo desaparecen. Los cromosomas dobles se alinean en el plano ecuatorial, los centrómeros se encuentran asociados a las fibras de polos opuestos

Figuras 59metafase II Fuente: diseñados por Carmen Eugenia Piña L

Anafase II Las cromátidas se separan, se forman dos cromosomas hijos, los cromosomas hijos emigran hacia los polos

90

Figuras 60anafase II Fuente: diseñados por Carmen Eugenia Piña L

Telofase II y Citocinesis

Figuras61 telofase II Fuente: diseñados por Carmen Eugenia Piña L

Se forman cuatro núcleos rodeados de membrana nuclear y con número de cromosomas haploides, las células se dividen por segunda vez por medio de la citocinesis.

Figuras62citocinesis II Fuente: diseñados por Carmen Eugenia Piña L

91

División Directa o Amitosis Amitosis Es un tipo de reproducción asexual que se da en los animales unicelulares. En este tipo de reproducción el organismo se divide en dos y cada célula resultante tiene las mismas características genéticas de la célula madre. Hay tres tipos de amitosis: fisión binaria o bipartición, gemación y esporulación. Fisión binaria o Bipartición Es un tipo de reproducción celular por medio de la cual una célula se divide en dos partes iguales estas se separan de la madre formando un núcleo propio y transformándose en otros organismos mas pequeños pero genéticamente idénticos a la madre. Es característico de organismos procariotas como las bacterias Gemación En este tipo de reproducción se forma una protuberancia o yema en la pared de la célula madre. Estas pequeñas protuberancias crecen llevándose a la vez una parte del núcleo y del citoplasma de la célula madre. Finalmente se desprenden y forman nuevos organismos. Ej.: la levadura Esporulación Es el tercer tipo de amitosis y se da cuando el núcleo de una célula se divide en muchas partes pequeñas. Estas se cubren con citoplasma formando esporas que pueden permanecer latentes cuando se presentan condiciones adversas. Cuando las condiciones son adecuadas o para su desarrollo, se dividen formando nuevas organismos con la misma información genética.

Capitulo 3 Organismos Pluricelulares y Unicelulares Lección 11 Tejidos, órganos y sistemas Los tejidos son grupos de células con un origen común, que cumplen una función específica dentro de un organismo.Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas, coordinar el funcionamiento de todas las funciones del organismo, es función del tejido: A. Oseo B. Conectivo C. Nervioso D. Cartilaginoso

92

La célula es el nivel de organización básico de los seres vivos que interesa a la biología. En la naturaleza los átomos están organizados en moléculas y estas en células. Las células forman tejidos y estos órganos, que a su vez se reúnen en sistemas, como el digestivo o el circulatorio entre otros. Un organismo vivo está formado por varios sistemas anatómico fisiológicos íntimamente unidos entre sí. Tejidos animales Los tejidos son grupos de células con un origen común, que cumplen una función específica dentro de un organismo. La ciencia que estudia los tejidos se denomina Histología.En los animales se encuentran básicamente cuatro tipos de tejidos:    

Epitelial, Conectivo, Nervioso Muscular.

Tejido epitelial El tejido epitelial según su función puede ser: tejido de revestimiento y tejido glandular, aunque puede tener función mixta. Tejido epitelial de revestimiento

Epitelio simple cúbico

Epitelio cilindrico simple

Epitelio seudoestratificado ciliado

Figuras63http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Se encuentra cubriendo la piel, u órganos internos como: el sistema digestivo, urinario, respiratorio y los vasos sanguíneos. Tiene función sensitiva, protectora contra daños mecánicos, de defensa al impedir la entrada de microorganismos, y en el intestino tiene función de absorción. Tejido epitelial glandular Especializado en secretar sustancias a la sangre o al exterior del organismo se encuentra en las glándulas endocrinas y exocrinas.

93

Glándula mucosa de la glándula mamaria

Glándula serosa del páncreas

Glándula sebácea del oído

Fiuras 64 http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Tejido conectivo Puede ser de tres tipos: conjuntivo, cartilaginoso, y óseo. Tejido conjuntivo

Tejido conjuntivo esófago

Tejido conjuntivo elastico en arteria

Figuras65http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

Forma la dermis de la piel, se encuentra en las submucosas de órganos como pulmones, corazón, órganos digestivos, en la parte interna de los vasos sanguíneos, en los tendones, en el tejido adiposo donde almacena grasa. Sus funciones son: sostén, defensa, protección, reparación, transporte de metabolitos, rellenar los espacios entre tejidos u órganos. Tejido cartilaginoso

Figura 66 http://facvet.lugo.usc.es/histologia/Apoyo/citologia/citología.htm

94

Es un tejido de sostén y soporte, se encuentra en el esqueleto de embriones en el tabique nasal, laringe, tráquea, bronquios, en los discos intervertebrales, en los meniscos de la rodilla. Es menos resistente y rígido que el óseo. Tejido óseo forma los huesos del cuerpo, tiene funciones de sostén, mecánica, y protección de órganos blandos. Es bastante rígido y resistente. Tejido nervioso

Figura 67Tomado de:http://www.joseacortes.com/galeriaimag/index.htm.joseacortes.com/galeriaimag/index.htm

Se encuentra formando todo el sistema nervioso (encéfalo, médula espinal, nervios), está formado por dos tipos de células: neuronas y células de glia. Las principales funciones del tejido nervioso son: Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas. Coordinar el funcionamiento de todas las funciones del organismo. Servir de sostén, nutrición y defensa del tejido nervioso función a cargo de las células de glia. Las neuronas o células nerviosas reciben información del exterior, se comunican entre si a través de sinapsis, deciden y actúan. Las sinapsis pueden producir mensajes excitatorios o inhibitorios. Las células de glia forman el tejido de sostén del sistema nervioso y son de tres tipos: astroglia, oligondendroglia cuya función es sostener y nutrir el sistema nervioso, además de formar la barrera hematoencefálica al adherirse a vasos sanguíneos y microglía encargadas de fagocitar los elementos nocivos para el sistema nervioso. Tejido muscular Hay tres tipos de tejido muscular: liso, esquelético o estriado y cardiaco.

95

Tejido muscular liso Se encuentra en los vasos sanguíneos, en las paredes del sistema digestivo, en la vejiga urinaria, en el útero y en el sistema respiratorio. Sus contracciones son lentas e involuntarias.

Tejido muscular liso Figura 68Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Tejido muscular estriado

Figura 69Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Se encuentra cubriendo los huesos del esqueleto, y en los esfínteres. Sus contracciones son rápidas y permiten el movimiento de las diferentes partes del cuerpo. Tejido muscular cardiaco

Figura 70Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

96

Es una variación del estriado, se encuentra en el corazón, permite mantener el latido cardiaco, sus contracciones son rápidas e involuntarias.

Lección 12Tejidos Vegetales Las células vegetales se agrupan, al igual que las de los animales, formando tejidos. Las plantas vasculares, adaptadas a la vida terrestre y aérea presentan tejidos diferenciados. Los tipos de tejidos vegetales son:     

Meristemático, protector, parenquimático, conductor y de sostén

Tejidos meristemáticos Son tejidos formados por células embrionarias con gran capacidad de división mitótica, permiten el crecimiento de las plantas. Pueden ser de dos tipos: primario y secundario.

Tejido meristemático en mitosis de cebolla Figura 71Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

El tejido meristemático primario se encuentran en la raíz, tallo, yemas (botones). Son responsables del crecimiento longitudinal de la planta. El tejido meristemático secundario se encuentra en toda la planta y es responsable de su crecimiento en grosor.

97

Tejidos protectores Tienen como función proteger a la planta de la desecación y de factores externos que puedan agredirla. Pueden estar localizados en la epidermis, corcho y endodermis de raíces, tallos y hojas.Las células epidérmicas forman una capa continua sobre la superficie del cuerpo de la planta. Su forma frecuentemente es tubular.

Figura 72Tejido epidermal de bulbo de cebolla Fuente:Carmen Eugenia Piña

Figura 73Tejido epidermal con estomas Tomado de: http://www.joseacortes.com/ galeriaimag/ index.htm

Tejidos parenquimáticos Tienen como función la producción y almacenamiento de alimento, la reserva de aire y agua, se divide en: clorofílico, de almacenamiento, aerífero y acuífero. La forma de sus células puede ser poliédrica, estrellada o alargada. Tejido parenquimático clorofílico o clorénquima se encuentra en las hojas y tallos verdes; tiene como función realizar la fotosíntesis por lo que presenta muchos cloroplastos.

Figura 74Tejido epidermal y parenquimático en hoja de Elodea 40X Fuente:Carmen Eugenia Piña

Tejido epidermal y parenquimático en hoja de Elodea 100X Fuente:Carmen Eugenia Piña

98

Tejido parenquimático de almacenamiento tiene como función almacenar almidones como en la papa, lípidos, proteínas. Se encuentra en raíces, bulbos, tallos subterráneos como tubérculos y rizomas y en las semillas.

Figura 75Tejido parenquimático en corte de papa 40X

Fuente:Carmen Eugenia Piña

Tejido parenquimático aerífero se localiza en las plantas acuáticas tiene como función almacenar agua permitiéndole a la planta flotar y realizar el intercambio gaseoso. Tejido parenquimático acuífero se presenta en plantas que viven en ambientes secos y necesitan de un tejido que almacene grandes reservas de agua. Es el caso de los cactus. Tejidos conductores Tienen como función el transporte de agua y sustancias minerales. Se divide en dos tipos: Xilema y Floema.

Xilema Figura 76Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

99

Xilema está formado por células muertas y endurecidas por lignina tiene como función conducir el agua y los minerales del suelo, desde la raíz hasta las hojas, además de servir de sostén a la planta. El crecimiento de los árboles se debe a la formación de nuevos canales de xilema que cada año van formando un anillo de crecimiento en el tronco. Al realizar un corte transversal de un tronco y observar los anillos se puede calcular la edad del árbol. Floema está formado por células vivas ubicadas en la parte externa del xilema, tienen como función conducir el alimento (azúcares y proteínas) desde las hojas hacia el resto de la planta. Tejido de sosténcomo su nombre lo indica permite a la planta mantenerse erguida. Hay dos tipos de tejido de sostén: colénquima y esclerénquima.

Colénquima Figura 77Tomado de: http://www.joseacortes.com/galeriaimag/index.htm

Colénquima está formada por células vivas. Se encuentra en tallos y hojas de plantas jovénes y herbáceas. Esclerénquima está formado por células muertas. Se encuentra en plantas leñosas y adultas, íntimamenterelacionado con el parénquima.

Lección 13 Estructura y Funciones Animales Órgano: Es un conjunto de tejidos que realizan una o varias funciones específicas. Sin embargo hay órganos que funcionan como parte de un grupo de órganos denominado sistema. Sistema:Es el conjunto de órganos homogéneos, relacionados entre sí, cada uno desarrolla actividades específicas para cumplir con una función común Aparato: Es el conjunto de órganos heterogéneos relacionados entre sí para que cumplir una función común

100

Todos los sistemas, digestivo, circulatorio, respiratorio, excretor, nervioso, endocrino, reproductivo, urinario, muscular y óseo interactúan para mantener en óptimo funcionamiento el organismo y ninguno de ellos funcionaría aisladamente. Por razones prácticas explicativas se analiza a continuación cada sistema. Sistema digestivo del hombre Todos los seres vivos, deben tomar del medio exterior los alimentos necesarios para obtener la energía requerida para realizar sus funciones y mantenerse con vida.Para poder utilizar los alimentos y convertirlos en energía el organismo realiza la función de la nutrición. Existen dos tipos de nutrición: autótrofa cuando los organismos producen su propio alimento como en el caso de las plantas y heterótrofa cuando el organismo necesita alimentarse de sustancias orgánicas ya elaboradas por las plantas o de otros organismos heterótrofos. Estas sustancias reciben el nombre de nutrientes y el conjunto de procesos que se llevan a cabo para obtenerlas y utilizarlas se llama nutrición. La nutrición comprende siete procesos: ingestión, digestión, absorción, circulación, respiración, asimilación y secreción. La ingestión es la toma de alimentos del medio, la digestión consiste en transformar los alimentos ingeridos en moléculas más pequeñas: los nutrientes, que pueden ser fácilmente absorbidos y distribuidos por todo el organismo. Podemos diferenciar dos tipos de digestion: la digestion mécanica, llevada a cabo por los dientes y por los movimientos peristálticos, que son movimientos musculares involuntarios que se originan para transportar el bolo alimenticio del esófago al estómago, y la digestión química, que es llevada a cabo por las enzimas y los jugos gastricos, que aceleran las reacciones químicas del metabolismo y transforman las macromoleculas de los alimentos en moleculas más simples. El proceso de nutrición se realiza a través de los órganos que conforman el sistema digestivo. El sistema digestivo esta formado por un tubo largo y musculoso que comienza en la boca y termina en el ano.

101

Figura 78Representación de la boca Fuente: Diseño Carmen Eugenia Piña L.

Figura 79Representación del sistema digestivo Fuente: Diseño Carmen Eugenia Piña L.

Figura 80Representación de los esfínteres cardias y piloro Fuente: Diseño Carmen Eugenia Piña L.

102

Tabla Estructura y función del sistema digestivo de los mamíferos Órgano

Función

Boca compuesta de: Aprehensión e ingestión del alimento, mezcla con la saliva y trituración física de labios, cavidad bucal, los alimentos, desdoblamiento parcial de carbohidratos por acción de la enzima lengua, dientes, amilasa salival, formación y deglución del bolo alimenticio hacia la faringe. glándulas salivares Faringe

Órgano común para los sistemas digestivo y respiratorio Comunicación de la cavidad bucal con el esófago durante la deglución con mecanismos de oclusión de los orificios que comunican con el sistema respiratorio.

Esófago

Transporte del bolo alimenticio del esófago al estómago a través del cardias (primer esfínter que los comunica) mediante movimientos peristálticos.

Estómago

Mezcla del bolo alimenticio con la enzima pepsina y con el ácido clorhídrico este último cumple acción bactericida y proporciona el pH ácido adecuado para acción de la pepsina sobre las proteínas para convertirlas en peptonas (digestión), formación del quimo y paso de éste a través del píloro (segundo esfínter) al intestino delgado.

Intestino delgado formado por tres partes: Duodeno, yeyuno e íleon con sus microvellosidades

Mezcla del quimo con:  sales biliares provenientes del hígado,  bicarbonato de sodio secretado por el páncreas para neutralizar la acidez del quimo y proporcionar el pH adecuado para la acción de las enzimas pancreáticas e intestinales.  jugo pancreático proveniente del páncreas y  jugo intestinal (entérico). El jugo pancreático e intestinal contienen diferentes tipos de enzimas que continúan con el proceso digestivo El jugo entérico contiene la lipasa entérica, la amilasa entérica y peptidasas, enzimas que continúan realizando el proceso digestivo es decir, convirtiendo las macromoléculas en moléculas de fácil absorción por las vellosidades del intestino delgado. El intestino delgado presenta tres tipos de movimientos: * oscilatorios o pendulares que permiten la mezcla del quimo con las enzimas de los jugos enterico y pancreático y con la bilis. * segmentarios dividen el quimo en fracciones más pequeñas * Peristálticoso evacuantes permiten que el quimo avance de la parte anterior hacia la parte posterior. Hay también movimientos antiperistálticos que devuelven el quimo en sentido contario.Todos estos movimientos tienen como finalidad favorecer la digestíón y absorción de los nutrientes.En las paredes del intestino se lleva a cabo la absorción que es el paso de los nutrientes (azúcares simples, ácidos grasos, glicerina, aminoácidos, y vitaminas; parte del agua y algunas sales minerales), por difusión al torrente sanguíneo y a la linfa para ser distribuidos por todas las células y tejidos.

103

Intestino grueso

Reabsorción de agua y minerales, Formación de heces formado por el colon y Almacenamiento de heces el recto Glándulas anexas Hígado Páncreas

Vesícula biliar

Productor de bilis Secreta bicarbonato de sodio y jugo pancreático. El jugo pancreático contiene: la lipasa pancreática que actúa desdoblando las grasas previamente emulsificadas por las sales biliares almacenadas en la vesícula biliar, las proteasas como el tripsinógeno que actúa sobre las peptonas convirtiéndolas en péptidos y aminoácidos , la amilasa pancreática que actúa sobre los azúcares degradándolos a fructuosa, glucosa o galactosa. Organo de almacenamiento de la bilis.

Animación Sistema digestivo

Sistema Circulatorio

Figura 81Representación del sistema circulatorio Fuente: Diseño Carmen Eugenia Piña L

El sistema circulatorio comprende el corazón que hace las veces de bomba impelente y el sistema vascular (arterias y venas) por donde circula la sangre El sistema cardiovascular contiene la sangre y es el encargado de transportar nutrientes y oxígeno a los tejidos y órganos y de recoger bióxido de carbono y

104

sustancias de desecho productos del metabolismo y llevarlas a los sistemas excretores. Este sistema transportador de líquido conserva la homeostasia interna del organismo.

Tabla: Estructura y función del sistema circulatorio de los mamíferos Estructura a) Sangre con sus componentes: Es un tejido formado por una parte sólida: las células sanguíneas de tres tipos: Eritrocitos o glóbulos rojos, leucocitos o glóbulos blancos, y las plaquetas y por una parte líquida el plasma.

Eritrocitos o glóbulos rojos

Función

Complementación

Respiración Vinculación con sistema respiratorio Defensa, Nutrición, vinculación con sistema digestivo. Excreción de productos del metabolismo a órganos de excreción vinculación con sistemas excretores Regulación de pH Regulación de presión osmótica Transporte de hormonas vinculación con sistema endocrino Regulación de presión sanguínea.

El 55% de la sangre es un líquido amarillo denominado plasma, el otro 45% son los componentes celulares

*Transporte de oxígeno y nutrientes a todos los tejidos del organismo.

* Su forma es biconcava los que les proporciona una mayor superficie de intercambio de oxígeno por dióxido de carbono en los tejidos.

En el plasma se encuentran proteinas como la albumina cuya función es mantener la presión ósmotica de la samgre; el fribrinógeno y la protrombina que participan en la coagulación de la sangre y algunas globulinas que defienden el organismo de agentes extraños. La cantidad de sangre que circula por el cuerpo es aproximadamente 1/12 del peso coprporal Ejemplo, en un adulto de aproximadamente 60 kilos de peso circulan 5 litros de sangre

*Recoger bióxido de carbono y sustancias de * Contienen la hemoglobina una desecho proteina que contiene hierro y les da la coloración roja y es la encargada de recoger el oxígeno de los pulmones donde se encuentra en alta concentración para luego liberarlo en los tejidos.

Fuente: Carmen Eugenia Piña

* Carecen de núcleo en el torrente sanguíneo. Constituyen el 40-45 % de la sangre * En el hombre la cantidad varía entre 5 a 5,5 y en la mujer 4,5 a 5 millones por cc3 de sangre

105

Leucocitos o glóbulos blancos

Defender el organismo de infecciones ocasionadas por la entrada de microorganismos patógenos, alergenos, mediante el proceso de fagocitosis

Su cantidad varía entre 4.600 a 6.000 por cc3 de sangre Son de cinco tipos: Eosinófilos, Basófilos, Neutrófilos con gránulos en el citoplasma y con un solo núcleo lóbulado por lo que se les denomina polinucleados; Linfocitos y Monocitos carecen de gránulos en sus citoplasma poseen un núcleo único no lóbulados.

Fuente: Carmen Eugenia Piña Plaquetas

El número de leucocitos es mucho menor que el de eritrocitos

Intervienen en la * Son fragmentos celulares, su número coagulación de la sangre esta comprendido entre 200.000 a 300.000 po rcc3 de sangre

Fuente: Carmen Eugenia Piña Corazón

Figura 82Representación del corazón Fuente: Diseño Carmen Eugenia Piña L

106

Estructura b) Corazón: un órgano muscular hueco (miocardio) con cuatro cavidades: dos superiores las aurículas y dos inferiores los ventrículos cuenta además con dos válvulas: la tricúspide que comunica la aurícula derecha con el ventrículo derecho y la bicúspide que comunica la aurícula izquierda con el ventrículo izquierdo

Función Bombear la sangre a todo el cuerpo. El corazón funciona ritmicamente para impulsar la sangre a todo el cuerpo durante la fase de contracción o sistole y para su llenado en la fase de relajación o diástole

Complementación El ventrículo izquierdo es más grande que el derecho pues es el que bombea la sangre a todo el cuerpo, mientras que el derecho sólo bombea la sangre a los pulmones. La función de las válvulas es impedir el retroceso de la sangre El corazón expulsa 5 litros de sangre por minuto

Principales Venas y Arterias

Figura 83Representación de los principales vasos del corazón Fuente: Diseño Carmen Eugenia Piña L Estructura

Función

c) Sistema vascular formado por :

Conducir sangre a los tejidos

Arterias Son tubos muy gruesos y elásticos; disminuyen su calibre a medida que se alejan del corazón, dando lugar a arteriolas, y luego a capilares. Su luz es menor que la de las venas.

Transportar la sangre oxigenada que sale del corazón. La única arteria que conduce sangre pobre en oxígeno y rica en bióxido de carbono es la pulmonar.

Complementación

Parten del corazón hacia los órganos y tejidos del organismo. Las principales son: la aorta que sale del ventrículo izquierdo emitiendo ramas hacia todo el organismo y las pulmonares que salen del ventrículo derecho hacia los pulmones.

107

VenasSon tubos de mayor diámetro que las arterias, menos elásticas y la mayoría poseen válvulas que impiden el retroceso de la sangre. Comienzan con vasos pequeños (capilares) y van aumentando su tamaño en sentido de la circulación hasta formar grandes vasos. Acompañan a las arterias en su recorrido hasta desembocar en la aurícula derecha del corazón.

Conductora, retorna la sangre desoxigenada al corazón. Las únicas venas que transportan sangre oxigenada son las pulmonares. Comienza con vasos pequeños y va aumentando su tamaño en sentido de la circulación

Las principales son: la vena cava inferior y la vena cava superior que traen sangre a la aurícula derecha del corazón y las venas pulmonares que transportan sangre de los pulmones al corazón..

Capilares Son vasos de calibre Intercambio de muy fino distribuidos en todos los sustancias en los tejidos órganos del cuerpo. Aportan nutrientes Recogen desechos

Circulación sanguínea La circulación es un circuito cerrado, se inicia en el corazón y termina en el corazón. La circulación se divide en circulación menor de corazón a pulmones y circulación mayor de corazón a todos los tejidos y retorno al corazón. Funcionamiento del corazón

1. La sangre rica en bióxido de carbono y pobre en oxígeno procedente de todo el cuerpo (circulación general) llega a la aurícula derecha por las venas cava superior e inferior.

2. La aurícula derecha se contrae (sístole), se abre la válvula tricúspide y la sangre desciende al ventrículo derecho.

3. Luego el ventrículo derecho se contrae, la válvula tricúspide se cierra, se abre la válvula pulmonar y la sangre va por la arteria pulmonar (que se ramifica en dos ramas derecha e izquierda) hacia el pulmón correspondiente donde es oxigenada.

108

4. En los capilares de los pulmones el bióxido de carbono es cambiado por el oxígeno del aire alveolar. (Circulación menor o pulmonar). La sangre oxigenada circula por vasos cada vez mayores que se reúnen en las venas pulmonares.

6. El ventrículo izquierdo se contrae y a través de la arteria aorta y sus ramificaciones envía la sangre oxigenada a todas las células y tejidos. 5. Luego la sangre rica en oxígeno por las venas pulmonares (las únicas venas que transportan sangre oxigenada) regresa a la aurícula izquierda del corazón. Esta aurícula se contrae y la sangre pasa a través de la válvula bicúspide al ventrículo izquierdo.

Animación sobre el ciclo cardiaco

Complementación El mecanismo de contracción del corazón es el siguiente: primero se contraen las dos aurículas y de forma sincrónica, es decir al mismo tiempo , período llamado Sístole Auricular, luego se contraen los dos ventrículos igualmente de manera sincrónica (Sístole Ventricular), y después, el corazón completo tiene una relajación (Diástole o reposo general), hasta que se produce la nueva Sístole Auricular. El funcionamiento del corazón es autónomoo involuntario, regido por el sistema nervioso autónomo o vegetativo

Figuras 83 a Representación del funcionamiento del corazón Fuente: Diseño Carmen Eugenia Piña L

109

Circulación portal

Figura 84Representación del funcionamiento del corazón Fuente: Diseño Carmen Eugenia Piña L

Los nutrientes que el organismo requiere pasan a través de las vellosidades del intestino delgado (segmento duodenal) a la vena porta que los transporta hasta el hígado donde éste los detoxifica y envía por la vena hepática al torrente sanguíneo. Coagulación sanguínea Adaptado de: http://www.canal-h.net/webs/sgonzalez002/Fisiologia/HEMOSTAS.htm

HEMOSTASISes el conjunto de mecanismos con los que se controla la pérdida de sangre del organismo. Estos mecanismos se desencadenan cuando hay un traumatismo o cuando hay pequeñas lesiones de forma espontánea en el organismo. Son fundamentales para la vida. Si se eliminan estos mecanismos, se ocasiona la muerte en pocas horas. Mecanismo de la hemostasisEstos mecanismos están interrelacionados entre ellos. Además, existe un tiempo determinado para cada uno e ellos. Siguen un orden preestablecido. Vasoconstricción: Cuando hay un traumatismo o una pequeña lesión, se produce una vasoconstricción de forma natural o por reflejos, estimulación de las terminaciones simpáticas que inervan la pared vascular.El objetivo es producir una contracción para que haya una disminución del flujo de sangre. l endotelio de los vasos sanguíneos segrega factores relajantes derivados del endotelio, que si está intacto, mantiene la estructura relajada. Cuando hay un traumatismo, desaparecen estos factores relajantes y se produce una contracción. Estos factores relajantes derivados del endotelio son el óxido nítrico (NO). A nivel vascular, el NO mantiene relajado ciertas estructuras vasculares. Cuando hay un traumatismo leve las

110

plaquetas se adhieren o agregan entre sí y liberan tromboxano A2 que produce una potente vasoconstricción. Formación del tapón plaquetario: las plaquetas, con forma más o menos redonda, cuando se encuentran en la sangre, tienen unos receptores en su membrana, de forma que, cuando detectan que en un vaso falta el endotelio y aparece el colágeno, las plaquetas forman la adhesión plaquetaria. Los receptores de la membrana de las plaquetas son receptores para residuos de aminoácidos del colágeno, de manera que hacen que las plaquetas se anclen contra el colágeno y se comience la adhesión plaquetaria (plaquetas adheridas al colágeno y que se vuelven mucho más planas). A nivel de la célula, se produce el incremento de calcio entre el reconocimiento entre colágeno y receptor. Cuando se incrementa el nivel de Ca2+ a nivel de la plaqueta, se produce la liberación de sustancias (tromboxanos A2 que producen vasoconstricción; ADP que favorece la adhesión de las plaquetas; es un feed-back negativo; los tromboxanos A2 también favorecen la adhesión plaquetaria; factor de crecimiento plaquetario que induce la mitosis en las células endoteliales; factor plaquetario 3, que sirve para favorecer la coagulación sanguínea.) La mitosis de las células endoteliales es el primer mecanismo de reparación. Las plaquetas se unen sólo en la zona lesionada, porque en la zona sana hay prostaglandinas I2 que son fuertemente antiagregantes. Coagulación sanguínea La coagulación es la modificación del estado físico de la sangre, que pasa de un estado líquido a otro de gel. Esta transformación se debe a que el fibrinógeno (proteína plasmática) se transforma en una red de fibrina, que refuerza el trombo plaquetario o tapón hemostático, para interrumpir de forma definitiva la hemorragia. Mecanismo de coagulaciónEste proceso necesita una serie de reacciones en varias proteínas plasmáticas, para transformarlas de un estado inactivo a otro activo, que a su vez, ayudará a que otra reacción del mismo tipo se dé con otra proteína. Estas proteínas plasmáticas se denominan "Factores de coagulación", de los cuales hay 13 que se denominan con números romanos, más otros factores que no tienen asignado numeral y que son los factores contacto. Los factores de coagulación Son un grupo de proteínas responsables de activar el proceso de coagulación. Hay identificados 13 factores ( I, II, ..., XIII). Factor I (fibrinógeno)

111

Factor II (protrombina) Factor III (factor tisular) Factor IV (calcio) Factor V (giobulina aceleradora) Factor VII (proconvertina) Factor VIII (factor antihemofílico) Factor IX (componente de tromboplastina en plasma) Factor X (factor de Stuart) Factor XI (antecedente de tromboplastina en plasma) Factor XII (factor de Hageman) Factor XIII (factor estabilizador de la fibrina

Vía Extrínseca de coagulaciónLa vía extrínseca se inicia cuando la sangre hace contacto con el tejido lesionado, que a su vez libera la tromboplastina tisular, que en presencia del factor VII y de iones de calcio, actúan sobre el factor X para formar factor X activado.El factor X activado, y en presencia de iones de calcio, libera el activador de la protrombina que favorece el paso de la protrombina (proteína del plasma que se produce en le hígado en presencia de vitamina K) en trombina (enzima de acción proteolítica), la cual a su vez actúa sobre las moléculas de fibrinógeno (otra proteína presente en el plasma sanguíneo y producida en el hígado) para formar monómeros de fibrina que al unirse entre ellas se polimerizan en largos hilos de fibrina que forman el retículo del coágulo.Para que el coágulo no se desintegre las plaquetas liberan el factor estabilizador de la fibrina. La Vía intrínseca de coagulaciónComienza con la activación del factor XII producida por el contacto con una superficie lesionada, esto es, sin endotelio. Esta activación, que requiere de enzimas, activa al factor XI, y éste activado activa a su vez al factor IX.El factor IX activado, junto con el factor VII activado, calcio, tromboplastina y otras sustancias, entre las que está el factor VIII, activan al factor X, punto de encuentro de la vía común. En la vía común, los factores X y V activados, en presencia de calcio y fosfolípidos plaquetarios trasforman la protombina en trombina, que hace que el fibrinógeno pase a ser fibrina, que es estabilizada con el factor XIII.En todas las reacciones de la cascada de la coagulación hay además otras sustancias que activan o inhiben las reacciones. El aumento o el déficit de los factores de la cascada, de las plaquetas o de los múltiples activadores o inhibidores de la coagulación pueden crear serios problemas, como pueden ser el que nuestro organismo no pueda responder favorablemente a las lesiones que sufren nuestros vasos, y podamos morir desangrados, siendo otro problema todo lo contrario, esto es, que el organismo cree trombos plaquetarios que obstruyen los vasos y que a su vez puedan desprenderse y causar obstrucciones a distancia.

112

Cascada de coagulación. Secuencia de reacciones que involucran varias proteínas conocidas como factores de coagulación. Los factores de coagulación actúan en cascada, es decir, uno activa al siguiente; si se es deficitario de un factor, no se produce la coagulación o se retrasa mucho. Sistema Linfático El sistema linfático es una red microscópica de capilares que se encuentran por todos los tejidos, transcurriendo entre los vasos arteriales y venosos. Su función es mantener el equilibrio entre los líquidos, devolviendo el exceso de líquido intersticial (aproximadamente unos 3 litros) a la circulación general. Está formado por: 

la linfa que es un líquido claro de composición parecida a la sangre contiene glóbulos blancos; su función es transportar los lípidos digeridos desde las vellosidades del intestino delgado hacia el torrente sanguíneo. 

los vasos linfáticos o conductos por donde circula la linfa, los capilares linfáticos. 

los ganglios linfáticos que son pequeñas estructuras en forma de riñón con gran cantidad de glóbulos blancos cuya función es filtrar la linfa , destruir y eliminar de ella las sustancias tóxicas y los microorganismos infecciosos antes de su circulación por el torrente sanguíneo. Sistema Respiratorio del hombre La respiración implica un intercambio de gases con el medio ambiente. Durante la respiración se realiza el transporte de oxígeno de la atmósfera a las células y a la inversa transporte de bióxido de carbono de las células a la atmósfera.Para realizar esta función el organismo cuenta con los pulmones y con unos conductos por los que circula el aire inspirado y expirado.

113

Figura 85: Aparato Respiratorio Modificado de http://www.emc.maricopa.edu/faculty/ farabee/BIOBK/humrespsys_1.gif

Los conductos o pasos del aire son: 

Las ventanas o fosas nasales por donde penetra el aire inspirado.



La cavidad nasal cuya función es filtrar, humedecer y calentar el aire inspirado. Para este fin su mucosa cuenta con una gran cantidad de vasos sanguíneos. 

La faringe permite el paso del aire a la laringe.



La laringe su función es regular el paso del aire en la respiración, impedir la entrada de cuerpos extraños a la tráquea y es el órgano principal de la fonación o de los sonidos. 

La tráquea es un tubo formado por anillos cartilaginosos que se bifurcan en bronquios. En su interior la tráquea y los bronquios cuentan con una serie de cilios que le permiten realizar su función de llevar secreciones o cuerpos extraños a la cavidad bucal impidiendo su entrada a los pulmones. 

Los bronquios se ramifican en bronquíolos de diámetro más reducido. Los bronquíolos terminan en pequeños saquitos denominados alvéolos los cuales se encuentran rodeados de capilares sanguíneos. 

Los pulmones se encuentran dentro de la caja torácica su interior está formado por un tejido esponjoso. Los pulmones son los órganos terminales donde se efectúa el intercambio gaseoso.

114



El diafragma y la caja torácica también se incluyen en las estructuras que toman parte de la respiración.

Mecanismos de la Respiración La respiración se realiza con dos mecanismos básicos de expansión y contracción de los pulmones por acción de: 

El diafragma que se contrae moviéndose hacia arriba acortando la caja torácica o se relaja desplazándose hacia abajo alargando la caja torácica. 

Las costillas que aumentan o disminuyen el diámetro de la caja torácica.

Durante la inspiración el diafragma se contrae, la caja torácica se eleva , su diámetro aumenta, los pulmones se distienden y el aire entra a los alvéolos. Para saber más Animación sobre inspiración expiración: http://www.youtube.com/watch?v=DHoYLeBafaw

Intercambio de gases en los pulmones

Figura 86Representación del alvéolo pulmonar rodeado de capilares Fuente: Diseño Carmen Eugenia Piña L

Debido a la diferencia de concentración de gases entre el exterior y el interior de los alvéolos, el oxígeno del aire pasa por difusión de los alvéolos a los capilares sanguíneos que rodean a los alvéolos, luego el oxígeno penetra en los glóbulos rojos o hematíes para ser transportado con el torrente sanguíneo a todas las células y tejidos.

115

Figura 87Representación del intercambio de gases en el alvéolo pulmonar Fuente: Diseño Carmen Eugenia Piña L

El bióxido de carbono se traslada en sentido opuesto desde los tejidos a los capilares y de ahí a los alvéolos. El mecanismo de la respiración es un acto reflejo casi por entero. Sistema excretor del hombre La excreción tiene como función mantener constante el volumen de los líquidos corporales, la concentración de los electrólitos y el equilibrio ácido - básico independientemente de las variaciones en la ingesta. La homeostasis de los líquidos corporales se conserva sobre todo por la acción de los riñones y está controlada por diversos mecanismos fisiológicos todos ellos interrelacionados.El sistema excretor en los mamiferos está formado por:

Figura 88Representación del sistema renal Fuente: Diseño Carmen Eugenia Piña L

116

Estructura Dos riñones formados por millares de nefronas que son la unidad estructural y funcional del riñón Dos Uréteres o tubos La Vejiga urinaria La Uretra

Función Producir la orina que es un producto de desecho tóxico Conducir la orina del riñón a la vejiga. Almacenar la orina. Excretar la orina de la vejiga al exterior

Funciones del Sistema Renal 

Filtración de la sangre y eliminación de sustancias de desecho resultantes del metabolismo celular. La sangre oxigenada le lleva al riñón nutrientes y oxígeno y la desoxigenada le trae del hígado la urea que se elimina con la orina.  Controlar el equilibrio hídrico a través de la orina.  Controlar el equilibrio electrolítico (sodio, potasio, calcio, fósforo, cloro entre otros).  Controlar el equilibrio ácido – básico (pH) Controlar la presión arterial por medio de la hormona renina que tiene acción hipertensora. La Nefrona

Figura 89La Nefrona Tomada de http://iris.cnice.mecd.es/biosfera/profesor/galeria_imagenes/images/circul6-6.jpg

La nefrona esta formada por un paquete o red capilar que recibe el nombre de glomérulo, envuelve a este sistema glomerular una cápsula de Bowman. La unión funcional entre la cápsula de Bowman y el glomérulo recibe el nombre de tubo de Malpighi y es el lugar donde ocurre la primera filtración del plasma sanguíneo que

117

contiene sustancias de desecho, además de sustancias como glucosa, sales minerales y agua que aún son útiles al organismo. En la cápsula de Bowman se forma la orina primaria.La cápsula de Bowman se continúa con un tubo renal contorneado proximal, de él se origina el asa de Henle. Esta asa se continúa con otros tubos contorneados distales. En los túbulos contorneados ocurre el segundo filtrado con la consecuente resorción de agua, glucosa y sales al torrente sanguíneo y secreción de sustancias de desecho.Los tubos contorneados distales van drenando a túbulos colectores para formar los cálices los cuales drenan en la pelvis renal. Los túbulos colectores reciben la orina formada en las nefronas.La pelvis renal comunica con los uréteres que llegan a la vejiga. Sistema Reproductor Los seres vivos tienen capacidad de dar origen a otros seres vivos. En los seres eucarióticos pluricelulares la reproducción implica la participación de gametos o células sexuales masculina y femenina las cuales se fusionan para originar un cigoto.Los órganos del aparato reproductivo masculino y femenino son los encargados de la producción de gametos

Aparato reproductor masculino del hombre

Figura 90Aparato Reproductor masculino Tomado de http://www.arrakis.es/~lluengo/reproduccion.html

118

Tabla Estructura y función del sistema reproductor masculino Órgano

Función Producción de espermatozoides o células sexuales masculinas Producción de la hormona testosterona que determina los caracteres masculinos. El escroto mantiene la temperatura adecuada Testículos contenidos en el escroto para los espermatozoides (unos tres grados por debajo de la temperatura del cuerpo) El parénquima testicular está formado por lóbulos donde se encuentran los túbulos seminiferos lugar donde se forman los espermatozoides. Epidídimo Almacenamiento y maduración de los Conducto alargado y flexuoso, adherido espermatozoides y conducción de los al testículo espermatozoides hacia los conductos deferentes Conductos eferentes Transportar los espermatozoides desde los tubos semíniferos hasta el epididimo Conductos deferentes Almacenamiento de los espermatozoides hasta el momento de la eyaculación Glándulas accesorias Producción de líquido viscoso denominado * Vesículas seminales semen, que se mezcla con los espermatozoides y sirve para transpórtalos. Secreción de líquido lechoso que da olor * Próstata característico al semen * Glándulas de Cooper Secreción de líquido que mantiene lubricada la uretra y el pene Pene Órgano copulador

119

Aparato Reproductor Femenino de mamíferos

Figura 91Aparato reproductor femenino Tomado de: http://www.arrakis.es/~lluengo/reproduccion.html

Tabla Estructura y función del sistema reproductor femenino de mamíferos Órgano Dos ovarios

Función Formación del los óvulos o células sexuales femeninas

Producción de estrógenos hormonas que dan los caracteres sexuales femeninos Dos trompas de Estos conductos comunican con el útero a donde Falopio transportan los óvulos. En el primer tercio de las trompas ocurre la fecundación Útero Recibir el óvulo fecundado, albergar y alimentar el embrión. En el caso de no haber fecundación su mucosa interna llamada endometrio se desprende produciendo la menstruación. Durante el parto se contrae para expulsar el feto. Cuello uterino Comunica la vagina con el útero Recibir el líquido seminal con los espermatozoides. Vagina Expulsa el feto durante el parto Órganos genitales externos: Vulva constituida por los labios mayores y menores Clítoris órgano de excitación

120

Fecundación Consiste en la fusión de los núcleos de los gametos o células sexuales masculina y femenina, es decir la unión del óvulo y del espermatozoide para formar el cigoto. La fecundación ocurre en las trompas de Falopio y a medida que el cigoto desciende por las trompas hacia el útero tienen lugar las divisiones celulares que dan comienzo al proceso embrionario o formación del embrión.

Sistema Nervioso El sistema nervioso coordina y preside el funcionamiento de todos los órganos y sistemas de los seres vivos. La función final del sistema nervioso es la conducta. El sistema nervioso percibe estímulos e informa sobre lo que ocurre en el entorno para que los comportamientos o conductas logren adaptarse y de esta amaner actuar de manera útil. Fisiológicamente el sistema nervioso se divide en sistema nervioso central, voluntario y sistema nervioso autónomo o involuntario. Las funciones del sistema nervioso central son: 

Poner en relación al organismo con el medio exterior en que vive.



Recibir información, coordinar y producir respuestas conscientes - función sensitiva. 

Producir movimientos musculares - función motora.



Proporcionar integridad al organismo - función integradora.

Las funciones del sistema nervioso autónomo son: 

Inervar vísceras de los aparatos: respiratorio, circulatorio, digestivo, urinario, glandular, reproductor. 

Coordinar las funciones de todos los sistemas.



Mantener la homeostasis.



Presidir la vida interior

121

Figura 92Sistema Nervioso Central Tomado de: http://personales.ya.com/erfac/snc.gif

Figura 93Encéfalo Fuente: Diseño Carmen Eugenia Piña L

122

Tabla: Estructura y función del Sistema Nervioso Central El sistema nervioso central está formado por: Órgano Encéfalo que comprende:

Cerebro

Cerebelo

Función

Órgano que permite utilizar todos los sentidos, en él se encuentran los centros del lenguaje de la escritura, de las imágenes auditivas, de la olfación, tacto, dolor, gusto, las zonas motoras; en el cerebro es donde todas las emociones toman forma: los pensamientos, la actividad imaginativa y el recuerdo. Interviene en el mantenimiento de la posición y el equilibrio del cuerpo, coordina los movimientos, mantiene el tono muscular.

Hipotálamo

El hipotálamo controla todas las funciones vegetativas o internas del cuerpo como: presión arterial, actividad sexual, equilibrio de líquidos corporales, alimentación, actividad digestiva, secreción de glándulas endocrinas, regulación de la temperatura, reacciones de defensa. Médula oblonga o Tiene el control de las funciones de los centros de la Bulbo raquídeo respiración, cardiaco, vasoconstrictor , respiratorio y del vómito Médula espinal Conduce información desde los nervios periféricos que vienen de diferentes partes del cuerpo hacia el encéfalo o desde el encéfalo al resto del cuerpo. Las prolongaciones Transportan los impulsos al sistema nervioso central y o nervios craneales llevan información al exterior. y espinales. Son motores y sensitivos y vienen de los órganos de los sentidos

Neurona La neurona o célula nerviosa es la unidad estructural y funcional del sistema nervioso. Su función es la trasmisión de información entre las diferentes partes del cuerpo.La mayoría de neuronas se encuentran en el cérebro y en la médula espinal, otras se encuentran el sistema nervioso periférico.En el hombre se encuentran entre cien y mil billones de neuronas

123

Figura 94La Neurona

Tomado de: http://mensual.prensa.com/mensual/contenido/2002/03/03/hoy/revista/468858.html La neurona consta de:  

Cuerpo con núcleo, citoplasma y organelos. Prolongaciones que son extensiones protoplasmáticas y son de dos tipos: dendritas y axón. Las dendritas son aferentes o sensitivas. Conectan una neurona con otra y conducen impulsos de órganos (articulaciones, músculos, tendones, huesos etc.) hacia el cuerpo de la célula nerviosa El axón que es eferente o motor. Conduce impulsos del cuerpo de la célula nerviosa hacia los botones terminales órganos o tejidos. En la terminación de los axones se encuentran los botones terminales Conducción dentro de la neurona Cuando una neurona se encuentra en estado de reposo su interior tiene una carga eléctrica ligeramente negativa con respecto al exterior. Esto ocurre porque dentro de la célula hay una cantidad importante de iones negativos debido a que la bomba de sodio impulsa hacia afuera de la fibra nerviosa los iones de NA+. Esta carga se denomina potencial de reposo. Cuando se estimula una neurona la permeabilidad de la membrana cambia permitiendo la entrada de iones positivos de Na+ al interior de la célula,

124

desapareciendo el potencial de reposo y generando un potencial de acción que viaja a lo largo de la neurona hasta los botones terminales. Cuando el potencial de acción llega a los botones terminales se liberan sustancias químicas o neurotrasmisores al espacio potsináptico (espacio entre la unión de dos neuronas) . Estos cambios en el potencial de membrana duran una pequeña fracción de segundos, seguidos inmediatamente al estado de reposo. El establecimiento del estado de reposo depende casi totalmente de la salida por difusión de iones de K+ al exterior. Receptores Sensoriales En el ser humano y animales superiores los estímulos del exterior son captados a través de receptores sensoriales u órganos de los sentidos. Los órganos de los sentidos son cinco: vista, oído, olfato gusto y tacto.El sistema sensorial está formado por un receptor, una neurona aferente sensitiva y el centro sensitivo en la corteza cerebral. Para que haya percepción y respuesta motora de un estímulo se requiere de un receptor, una neurona aferente, un centro coordinador y decodificador de la información, una neurona eferente o motor Sistema Sensorial Adaptado de: http://www.uc.cl/sw_educ/neurociencias/html/frame04.html

Los sistemas sensoriales son conjuntos de órganos (órganos de los sentidos)altamente especializados que permiten a los organismos captar una amplia gama de señales provenientes del medio ambiente. Ello es fundamental para que dichos organismos puedan adaptarse a ese medio. Pero, para los organismos es igualmente fundamental recoger información desde su medio interno con lo cual logran regular eficazmente su homeostasis. Para estos fines existen sistemas de detectores con una organización morfofuncional diferente y que podemos llamar receptores sensitivos.

125

Figura 95 Generalidades del sistema sensorial

Los receptores están ligados a sistemas sensoriales/sensitivos capaces de transformar la energía de los estímulos en lenguaje de información que manejan los organismos (señales químicas, potenciales locales y propagados). Es decir, son capaces de transducir información. En cada sistema sensorial o sensitivo es fundamental la célula receptora. Es ella la célula transductora, es decir, la que es capaz de traducir la energía del estímulo en señales reconocibles y manejables (procesamiento de la información) por el organismo. Esas señales son transportadas por vías nerviosas específicas (haces de axones) para cada modalidad sensorial hasta los centros nerviosos. En estos, la llegada de esa información provoca la sensación y su posterior análisis, por esos centros nerviosos, llevará a la percepción. La sensación y la percepción son entonces, procesos íntimamente ligados a la función de los receptores Los receptores sensoriales son células, especialmente nerviosas, altamente especializadas, encargadas de reconocer y convertir en forma específica diferentes formas de energía presentes en el medio ambiente o en el medio interno de un organismo en señales bioeléctricas que son transportados a centros nerviosos específicos. Según el tipo de estímulo que excita las células sensoriales, se pueden clasificar los receptores en grandes grupos: mecánicos, químicos , térmicos yluminosos Para saber más En el siguiente linkhttp://bibi.avila.googlepages.com/receptoressensorialeshumanos encuentra una descripción muy didáctica de los Receptores sensoriales humanos. Complementación realizada por la tutora Bibiana Avila. Se recomienda aprovechar este material.

126

Organo de la Visión El sentido de la vista se sitúa en los ojos. En los animales superiores es par, ubicado en el interior de los huesos de la cara, en las cavidades orbitarias que presenta la parte anterior de la cabeza. Está constituido por el globo ocular y otros órganos anexos. Básicamente es una cámara cerrada con la parte anterior transparente para permitir la entrada de la luz, y una zona interna sensible donde convergen los rayos luminosos para formar la imagen. El globo ocular está compuesto por tres membranas concéntricas cuya parte más externa es la esclerótica o blanco del ojo, consistente en un tejido opaco, fibroso y duro, salvo en su zona anterior que es transparente y convexa formando la córnea, y su zona posterior que está perforada para dar salida al nervio óptico. La parte intermedia del globo ocular, desde la esclerótica hasta la retina, es un tapizado muy vascularizado llamado coroides, que finaliza por delante mediante un anillo multiciliar blanquecino (anillo circular) en la unión entre la esclerótica y la córnea. Tras la córnea se sitúa una cámara acuosa transparente (humor acuoso), en medio de la cual se halla el iris; éste es un diafragma musculoso, contráctil y opaco, en cuyo centro está la pupila o niña, la cual regula la cantidad de luz que penetra en el ojo variando su diámetro, función que es llevada a cabo mediante la contracción o dilatación de sus músculos circulares y radiales. Detrás del iris está el cristalino, un cuerpo lenticular, transparente y biconvexo cuya misión es hacer converger los rayos luminosos de manera que formen imágenes en la retina; la pérdida de transparencia del cristalino da lugar a una enfermedad conocida vulgarmente como cataratas. La capa más interna del globo ocular es la retina, constituida por diez capas superpuestas que acoge variados elementos nerviosos y de sostén; sus células (conos, bastoncillos, neuronas bipolares y multipolares) se prolongan y agrupan para constituir el nervio óptico, el cual parte de un punto llamado ciego, debido a que en él no se produce ninguna visión. Las células de la retina contienen una materia pigmentaria altamente sensible a las impresiones luminosas que recibe, y que producen la sensación visual; la zona de mayor agudeza visual es la posterior, llamada fóvea, mácula o mancha amarilla. Los conos de la retina se relacionan con esa agudeza visual, mientras que los bastoncillos tienen que ver con las condiciones de escasa iluminación. Todo el resto del globo ocular está ocupado por el llamado humor o cuerpo vítreo

127

Figura 96 Organo de la visión

Órganos anexos Los órganos anexos del globo ocular están constituidos por las glándulas lacrimales, órbitas, cejas, párpados, pestañas y seis músculos. Las glándulas lacrimales se sitúan en la parte más externa de la cavidad orbitaria, en su región antero-superior. Existen dos por cada ojo: una principal o superior y otra accesoria o inferior, cada una de ellas comunicada con el ángulo más externo del ojo y las fosas nasales mediante un conducto lacrimal. Estas glándulas son las encargadas de segregar las lágrimas, un líquido ligeramente alcalino, lubricante y limpiador de la superficie ocular Los párpados, superior e inferior, son repliegues cutáneos movibles, unas láminas fibrosas tapizadas exteriormente por la piel, e interiormente por mucosa y la conjuntiva, una membrana transparente que recubre también la córnea. Los párpados poseen unas glándulas que segregan grasa llamadas de Meibomio, en referencia al médico anatomista alemán Heinrich Meibom (1638-1700) que las descubrió y estudió. En el borde de los párpados se encuentran las pestañas, unos pelillos tamizadores de la luz, que limpian el ojo y las ya citadas glándulas de Meibomio. También se encuentran los seis músculos motores del ojo, los cuales permiten su movimiento y sujeción: los cuatro rectos (interno, externo, superior e inferior), y dos oblicuos (pequeño y grande). Los músculos del ojo se controlan por pares de nervios craneales (motor ocular común, patético y motor ocular externo).

128

Figura 97 Órganos anexos de la visión

Mecanismo de la visión La visión es un proceso fisiológico, resultado de varios fenómenos sucesivos, que nos permite revelar la presencia de los cuerpos, con identificación de su forma, color y dimensiones. En ese proceso intervienen el ojo y la zona de la corteza cerebral encargada de interpretar las sensaciones luminosas que se proyectan sobre la retina de aquél. La visión es pues una actividad que implica la necesidad de luz; sin ella no existe visión. El mecanismo de la visión se produce de forma similar al utilizado para obtener la imagen en una cámara fotográfica. Así como en la cámara existe una película sensible a la luz que se sitúa detrás del objetivo, en donde se materializa la impresión de la imagen captada, en el ojo esa función la realiza la retina, donde las células receptoras son estimuladas para después conducir los impulsos nerviosos que generan hacia el cerebro. En la cámara se regula la cantidad de luz que penetra en el interior mediante un diafragma mecánico; de manera homóloga. El ojo utiliza el iris como diafragma, contrayendo o relajando los músculos que lo gobiernan.En ambos ejemplos, tanto la imagen formada en la retina como en la película se proyecta invertida, es decir, si visualizamos un árbol éste se proyecta con la copa hacia abajo y la base hacia arriba, sin embargo, en el ojo humano esa característica es interpretada correctamente tras ser enviada por el nervio óptico hasta el lóbulo de la corteza cerebral correspondiente. Por su parte, la mayoría de cámaras permiten ajustar el enfoque del objeto que se desea impresionar; en el ojo esa función la llevan a cabo los músculos ciliares del cristalino, que acomodan el ojo para enfocar los objetos según la distancia a que se encuentren. Oído En los animales superiores el oído es el órgano sensorial de la audición, también acoge otro sentido, el del equilibrio, que se encuentra en los canales semicirculares del oído interno. Es par, y se halla situado a uno y otro lado de la

129

cabeza. Consta de tres partes: oído externo (oreja y conducto auditivo), oído medio (caja del tímpano), y oído interno (laberinto).

Figura 98 Organo de la audición

El oído externo comprende el pabellón u oreja y el conducto auditivo. El pabellón consiste en una lámina replegada e internamente cartilaginosa, cuya misión es conducir las ondas sonoras hacia el conducto auditivo. Éste es un tubo de unos 3 cm. de longitud, de cartílago al principioy óseo en su parte final, en la membrana del tímpano. Este conducto acoge las glándulas sebáceas y ceruminosas segregadoras del cerumen. El oído medio comienza en la caja del tímpano, una cavidad del hueso temporal que a través de dos orificios o ventanas (la oval y la redonda) comunican con el oído interno por su parte posterior. La faringe también se comunica con el oído a través de un orificio existente en el canal de la trompa de Eustaquio, de esta forma la presión interior y exterior quedan equilibradas. En el oído medio se distingue una cadena de cuatro huesecillos movibles y conectados entre sí, que se sitúan entre el tímpano y la ventana oval. Son el martillo, yunque, lenticular y estribo. Su función es transmitir las ondas sonoras El oído interno se sitúa detrás de la caja del tímpano. Comprende el laberinto, caracol o coclea y canales semicirculares.El Caracolo coclea consiste en una cavidad en la que reside el llamado órgano de Corti, en alusión a su descubridor, el anatomista italiano Alfonso Corti (1822-1876). Es un órgano arrollado en espiral, ósea en su parte externa y membranosa en la interna; entre ambas partes se encuentra un líquido llamado perilinfa, y en el interior de la membranosa se halla otro líquido llamado endolinfa. En el caracol residen las terminaciones ciliadas de las células sensitivas del oído.Laberintoestá constituido por un conjunto de cavidades situadas en el interior del peñasco del hueso temporal, por dentro de la

130

caja del tímpano. Su parte externa es ósea y en su interior se halla el laberinto membranoso formado por el utrículo (saco del que parten los tres canales semicirculares) y sáculo (bolsa que comunica con el caracol). Éstos y los canales contienen endolinfa, en ellos reside el sentido del equilibrio. Mediante los movimientos de la endolinfa las células sensoriales de los canales envían impulsos al cerebro, informando sobre la posición de la cabeza, permitiendo así mantener el equilibrio. Cuando el nivel de la endolinfa se altera por cualquier motivo, se produce entonces una pérdida de orientación dando lugar a mareos. El Olfatoes un sentido quimiorreceptor, como el del gusto, que se estimula mediante las sustancias volátiles que se desprenden de los cuerpos, o las que se encuentran en estado gaseoso, permitiendo así percibir los olores. Está constituido por el nervio olfatorio y sus terminaciones nerviosas, las cuales se diseminan por la parte superior de la mucosa pituitaria, que tapiza las fosas nasales. Los impulsos nerviosos se transmiten a través de las terminaciones nerviosas hasta el bulbo raquídeo, y desde éste hacia la corteza cerebral olfatoria. El sentido del olfato es fácilmente fatigable, ya que tras un corto periodo de tiempo sometido a la percepción de un olor de nivel estable, éste deja de percibirse por adaptación de los receptores olfatorios El Gusto es un sentido quimiorreceptor, como el del olfato, que se localiza en la boca. Las sensaciones del gusto son percibidas en aquellas sustancias líquidas o disueltas, mediante receptores gustativos de tipo químico, los cuales se agrupan en los llamados botones gustativos u olivas, que se sitúan en los laterales de las papilas linguales. Los impulsos nerviosos de estas sensaciones son transmitidos por los nervios craneales (lingual y glosofaríngeo) al bulbo raquídeo y a la corteza cerebral. El Tacto se localiza en la piel. Se trata de una forma exteroceptiva de sensibilidad, que permite detectar y localizar sobre la superficie cutánea el estímulo por diferencia de presión que produce un objeto, e incluso determinar su textura. El tacto reside fundamentalmente en las terminaciones nerviosas y corpúsculos táctiles, que se localizan en la epidermis y en el espesor de la dermis. La abundancia de corpúsculos táctiles se relacionan directamente con la mayor o menor agudeza táctil. El tacto también permite transmitir sensaciones térmicas y dolorosas, pero a través de otros puntos sensibles distintos y en localizaciones diferentes de los citados puntos táctiles. Para Saber más Profundización sugerida para estudiantes de Psicología y Regencia en Farmacia: Curso sobre estructura, desarrollo, funciones del sistema nervioso de la Pontificia Universidad Católica de Chile http://www.uc.cl/sw_educ/neurociencias/

131

Sistema Músculo Esquelético El sistema músculo-esquelético tiene como función el movimiento de los animales y el hombre.La estructura funcional del sistema esquelético está formada por los huesos los cuales forman el sistema esquelético axial que comprende cráneo y caja torácica; y el apendicular formado por las extremidades.Los huesos se unen a través de las articulaciones, que son móviles e inmóviles.El sistema muscular recubre el sistema esquelético, y está conformado por músculos estriados voluntarios. El sistema muscular se caracteriza por la contractibilidad, la excitabilidad y elasticidad.La contracción muscular está determinada por dos proteínas la actina y la miosina. Para Saber más Profundización Curso sobre el sistema óseo de la Universidad Estatal de California, Chico, sugerido para estudiantes de todos los programas http://www1.universia.net/CatalogaXXI/pub/ir.asp?IdURL=84322&IDC=10010&IDP=ES&IDI=1

Esta conformado por un conjunto de glándulas de secreción interna de hormonas, las cuales son mensajeros químicos que producen efectos fisiológicos en el organismo, como respuesta coordinada ante los mensajes del sistema nervioso.El sistema endocrino tiene como función regular las actividades internas de los seres vivos a través de sus relaciones con el sistema nervioso el cual ha tomado el nombre de sistema neuroendocrino a través de un proceso de retroalimentación.La regulación del sistema endocrino se hace a través de proteínas especializadas denominadas hormonas, las cuales son producidas por glándulas específicas como la hipófisis, tiroides, suprarrenales, páncreas y gónadas. Las hormonas regulan muchos procesos biológicos como el crecimiento, metabolismo, reproducción y funcionamiento de los diferentes órganos. Canalización del efecto hormonal Las hormonas se transportan por vía sanguínea y entregan su mensaje a determinados conjuntos de células que tengan receptores químicos específicos en sus membranas. Tipos de hormonas y su acción La acción de las hormonas se ejerce mediante mecanismos bioquímicos, en dependencia de su naturaleza específica, como se explica a continuación:

132

a) Hormonas esteroideas: Son mensajeros químicos de naturaleza lipídica apta para atravesar las membranas celulares hasta localizar receptores proteicos en el citoplasma. El efecto se desencadena en el núcleo celular al inducir la actividad de sínteis proteica mediante la desinhibición de ciertos genes, que logran la transcripción de mensajes de ARNm. b)Hormonas proteicas: no atraviesan la membrana celular pero transmiten su mensaje químico desde la superficie de dicha membrana mediante un receptor de AMPc que sí llega al núcleo celular y activa enzimas desencadenantes de efectos metabólicos. El ciclo de retroalimentación hormonal La primera etapa de los procesos de retroalimentación hormonal comienza en el hipotálamo, glándula que secreta neurohormonas que emigran a la hipófisis, donde desencadenan la producción de hormonas trópicas (tireotropa, corticotropa, gonadotropa), encargadas de llevar los mensajes a las diversas glándulas del organismo para inducir la secreción de las hormonas de acción directa sobre el cuerpo, como son la tiroxina, los corticosteroides y las hormonas sexuales, las cuales al alcanzar ciertos niveles retroalimentan a la hipófisis y al hipotálamo para que cesen su acción estimulante y equilibren su interacción con la glándula ya accionada. Glándulas y funciones hormonales En el siguiente cuadro se presenta un resumen de las diversas glándulas que conforman el cuerpo humano, las hormonas que secretan y sus respectivas funciones: Glándula

Hipófisis

Adenohipófisis (lóbulo anterior)

Hormona que secreta Trópicas: TSTH o tireotropa

Función Estimulan a las glándulas En la tiroides, controla la secreción de tiroxina Regula las hormonas ACTH o adrenocorticotropa suprarrenales. FSH o folículo estimulante Induce secreción de estrógenos en los ovarios y maduración de espermatozoides en los testículos Induce secreción de progesterona por el cuerpo lúteo LH o luteotropina y de testosterona por los testículos. Actúan directamente sobre las No trópicas: células

133

STH o somatotropina PRL o prolactina Lóbulo medio Neurohipófisis (lóbulo posterior)

MSH o estimulante de los melonóforos Oxitocina

Controla el crecimiento de huesos y cartílagos. Induce la secreción de leche en las glándulas mamarias. Induce la síntesis de melanina.

Estimula las contracciones del útero en el parto y la secreción láctea ante la succión de la glándula mamaria. Estimula la reabsorción de Vasopresina o ADH agua(antidiuresis) por las nefronas. Regula el metabolismo y el Tiroxina desarrollo. Tiroides Induce la transferencia del calcio Calcitonina de la sangre a los huesos. Induce la absorción intestinal del Paratiroides Parathormona calcio de la sangre (acción contraria a la calcitonina). Induce la absorción de la Insulina u hormona glucosa de la sangre en las hipoglucemiante (en células células del hígado y del tejido alfa) muscular, para su transformación en glucógeno. Páncreas (en los islotes de Langerhans). Estimula la concentración de Glucagón u hormona glucosa en la sangre por hiperglucemiante (en células descomposición del glucógeno beta). del hígado (acción antagónica de la insulina). Sus 3 capas segregan En la corteza: hormonas. Mineralocorticoides: (en parte Formación de glúcidos y grasas más externa) a partir de los aminoácidos. aldosterona Incrementa resistencia antiestrés. Decrece linfocitos y eosinófilos. Glucocorticoides (en la parte Formación de glúcidos y grasas Glándulas suprarrenales media): cortisona a partir de los aminoácidos. Incrementa resistencia antiestrés. Decrece linfocitos y eosinófilos. Andrógenocorticoides (en la Controla la aparición de parte más interna): hormonas caracteres sexuales la pubertad. masculinas y femeninas. En la médula: Influyen en el metabolismo de

134

Adrenalina Noradrenalina Andrógenos: testosterona Gónadas

Estrógenos Progesterona

los glúcidos. Vasodilatación e incremento gasto cardiaco. Vasoconstricción y disminución gasto cardiaco. Producción espermatozoides y caracteres masculinos Regulación menstrual y caracteres femeninos. Es la hormona del embarazo.

Ubicación de las glándulas del sistema endocrino humano

Figura 99Glándulas endocrinas Fuente: Diseño Carmen Eugenia Piña L

Lección 14Estructura y Funciones Vegetales Las plantas son organismos que contienen pigmento verde o clorofila, esencial para realizar el proceso de fotosíntesis a partir del cual producen alimento y liberan energía, mecanismo conocido como nutrición autótrofa. Antes de referirse a los órganos de las plantas, es necesario conocer la diferenciación entre plantas vasculares y no vasculares, aspecto que incide en las características de algunos órganos de las mismas.

135

Las plantas no vasculares no poseen tejidos conductores, no poseen raíces verdaderas en su lugar tiene rizoides a través de los cuales absorben agua y nutrientes del suelo, no tienen tallos ni hojas verdaderas. Un ejemplo de estas plantas son los musgos de gran importancia en la naturaleza por ser reservorios de agua y por contribuir en los procesos de meteorización. Las plantas vasculares tienen tejidos conductores, raíces, tallo y hojas verdaderas como es el caso de los helechos. Algunas, las gimnospermas además poseen flores y semillas desnudas, es decir, la semilla no se desarrolla dentro de un fruto, como es el caso de los pinos, otras las angiospermas además poseen frutos.Las angiospermas se dividen en monocotiledóneas y dicotiledóneas. A continuación se resumirán las principales monocotiledóneas y plantas dicotiledóneas: Tabla: Principales dicotiledóneas.

diferencias

entre

diferencias

plantas

entre

plantas

monocotiledóneas

Monocotiledóneas

Dicotiledóneas

Pertenecen a este grupo los pastos, los lirios, la caña, el maíz y las palmas

Pertenecen a este grupo el resto de plantas superiores

Tienen un solo cotiledón

Poseen dos cotiledones

Tienen hojas estrechas, largas y con nervadura paralela

Tienen hojas anchas con nervadura ramificada

y

136

Su raíz es fibrosa, no posee raíz principal

Poseen raíz principal y raíces secundarias.

Organización externa de las plantas Los órganos vegetativos Son aquellos órganos de la planta que sirven para mantener la vida individual de la planta y son: raíz, tallo y hoja. La raíz

Figura 100 Partes de la raíz Fuente: Material gráfico cedido po-la A.C. Nitella Flexilis publicado en url www.sobrado-es.com

La principal función de la raíz es la absorción del agua y sales minerales del suelo y la fijación de la planta al mismo sustrato. Además contribuye a evitar la erosión al mantener aglutinadas sus partículas. Las partes de la raíz son la cofia que se encuentra en la punta de la raíz cubriendo el ápice, sus células efectúan la absorción de nutrientes, por encima de la cofia se encuentra una zona en donde las células están en constante reproducción, es la

137

zona de crecimiento apical o meristemático inmediatamente después se halla la región de alargamiento. A continuación se encuentra la zona de maduración en donde las células alargadas se diferencian y convierten en tejidos, esta región está provista de pelos radiculares cuya función es la de incrementar la superficie de absorción La raíz principal es la primera en brotar y penetrar en la tierra, luego brotan las raíces secundarias laterales hasta desarrollar el sistema radicula. Si la raíz principal sobrepasa en tamaños las raíces laterales, este sistema se llama pivotante. Este sistema es característico en muchas plantas dicotiledóneas, por ejemplo en todos los árboles y arbustos de clima medio

Figura 101 Maduración de la raíz Fuente: Diseño Carmen Eugenia Piña L

Las plantas monocotiledóneas carecen de raíz principal, por ejemplo del tallo de maíz brota un gran número de raíces que le sirven de sostén al tallo. Estas raíces que brotan del tallo y en algunas plantas de la hoja, se denominan raíces adventicias.

Figura 102 Raices adventicias Fuente. Material gráfico cedido po-la A.C. Nitella Flexilis publicado na url www.sobrado-es.com

138

El sistema radicular formado por raíces finas y ramificadas carente de raíz principal se denomina fibroso y es característico de todas las plantas monocotiledóneas, pero a veces se forma en las dicotiledóneas de producción vegetativa. Las raíces que crecen de tubérculos, de pecíolos de hojas o de pedazos de tallo, poseen sistema radicular adventicio Modificaciones de la raíz En sistemas pivotantes como la zanahoria o en la remolacha, en la raíz principal se almacenan nutrientes, este sistema de raíz pivotante se denomina napiforme. En sistemas radiculares fibrosos también se presentan modificaciones, como sucede con la arracacha, la yuca que forman raíces carnosas tuberosas.

Figura 103 Raiz napiforme Fuente: Diseño Carmen Eugenia Piña L

El Tallo El tallo es el órgano que conecta la raíz y las hojas entre sí. Las funciones primordiales del tallo son soporte y conducción del agua y sales minerales a las hojas y de sustancias elaboradas de la hoja a la raíz. Algunas plantas se reproducen por medio del tallo (reproducción vegetativa), en muchas plantas los tallos acumulan sustancias alimenticias. El tallo y las raíces de una planta trabajan conjuntamente, desempeñando funciones diferentes pero estrechamente relacionadas, los tejidos que constituyen

139

las raíces y los tallos son similares, aunque los órganos en sí tienen diferencias estructurales importantes. Los tallos, lo mismo que las raíces, crecen de formas y tamaños muy diferentes, unos son troncos de los árboles gigantes que se elevan cientos de metros en los bosques, algunos solo viven algunas semanas, pero otros duran siglos. Existen muchos tipos de tallos con caracteres externos e internos diferentes: • Tallo leñoso. Posee una consistencia dura, entre ellos se cuentan árboles, arbustos y bejucos leñosos. • Tallo herbáceo: De consistencia maciza o hueca, son erguidos, los claveles, la hierbabuena y otras plantas de jardín. • Tallo de monocotiledóneas: De consistencia maciza o hueca, son erguidos y cilíndricos como el de la guadua, el maíz, los pastos y las palmas. • Tallos modificados: Son tallos que poseen forma y función excepcional. Entre ellos el cladodio, los rizomas y los zarcillos. • Cladodio: tallos aparentemente sin hojas, por ello realiza la función de fotosíntesis y transpiración. Son suculentos, ejemplo: cactus. • Estolón: En la fresa, frambuesa, ahuyama, calabaza, el estolón es un tallo con entrenudos finos y largos con hojas en forma de escama. Se encuentra en la superficie del suelo y es útil en la reproducción vegetativa. • Bulbo: Es un tallo subterráneo corto y grueso y envuelto en varias hojas. Su función es el almacenamiento de sustancias alimenticias y la conservación y la protección de las yemas en tiempos muy fríos o muy calientes y secos. Este bulbo es útil en la reproducción vegetativa. Ejemplo: Cebolla. • Rizoma: Tallo subterráneo como en el lirio, es grueso y carnoso, crece horizontalmente sobre la superficie del suelo, útil n la reproducción vegetativa. • Zarcillo: Como en la uva, sirve más como medio de soporte del tallo a otros elementos. Como fríjol, badea, pepino. Estructura del tallo Al observar un tallo podemos encontrar las siguientes estructuras:

140

Figura 104Estructura del tallo

• Nudos: Pequeños puntos donde se adhieren las hojas. • Entrenudos: espacio entre nudo y nudo. • Yema apical o Terminal: Yema que se localiza al final del crecimiento longitudinal del tallo. • Yemas laterales: Se localizan en el ángulo formado por el pecíolo de la hoja y la continuación del tallo. • Cicatrices de escamas: Indican donde estuvo ubicada la yema Terminal. Sirven para detectar la edad de la ramita. • Ramas: Formaciones laterales del tallo, dan mejor extensión a la planta y facilitan una mejor utilización de la luz para la fotosíntesis. La hoja

Figura 105 Estructura de la hoja

141

Su principal función es la fotosíntesis y la transpiración, además sirve de protección a las yemas laterales. Las principales partes de la hoja son: el limbo o lámina, el pecíolo y en algunas las estípulas.Las hojas poseen las más diversas estructuras morfológicas especialmente en su limbo, que puede ser de diferentes tamaños y formas La forma de las hojas varía ampliamente, dependiendo de la forma del limbo, base, ápice y tipo de borde, por lo que solo se presentan las más comunes. Según su forma • Oval. • Cordada en forma de corazón. • Deltoidea. • Acicular (en forma de aguja). • Linear (larga y angosta). • Lobulada (en forma de varios lóbulos). • Compuesta (formada de foliolos). • Lanceolada. • Arriñonada. • Espatulada. • Elíptica.

Figura 106 Hojas según su forma

Imagen Tomada de www.juntadeandalucia.es/.../imagenes/imagen2.jpg

142

Venación • Reticular: Los nervios presentan ramificaciones • Paralela: Los nervios van paralelos de un lado a otro.

en

forma

de

red.

Borde • Entero: Liso sin hendiduras. • Dentado: Hendiduras. • Aserrado. Borde. La disposición de sus hojas • Alterna. • Opuestas. • Verticiladas. Modificaciones de la hoja Algunas de ellas son suculentas, gruesas y carnosas retienen agua, ejemplo: aloe o sábila, algunas plantas desérticas poseen tallos suculentos y sus hojas están formadas por espinas que protegen la pérdida de agua de la planta y actúan como órgano de defensa. Ejemplo: cáctus. Órganos reproductores de la planta La Flor

Figura 107 La flor Tomado de: http://www.juntadeandalucia.es/averroes/concurso2004/ver/09/partes.htm

143

Las flores son órganos reproductores de las plantas superiores, de la cual resultan las semillas, portadoras de los caracteres genéticos para la siguiente generación. Morfología de la flor Al observar una flor vemos que consta de cuatro partes o verticilios florales unidos al extremo modificado del tallo o receptáculo El cálizEl primer verticilio de la flor formado por los sépalos, cuya función es la protección de la yema floral, y los verticilios internos.Existen dos tipos de cáliz: dialisépalo que presenta sépalos libres y gamosépalo. CorolaFormada por los pétalos de variados colores, su función es atraer a los insectos útiles en la polinización.Al igual que el cáliz la corola puede ser dialipétala es decir con los pétalos separados o gamopétala con los pétalos soldados. La simetría de la flor puede ser de dos tipos: Radical o actinomorfa cuando los pétalos son de igual tamaño y de distribución uniforme que permiten que la flor sea dividida en cuatro (4) o más porciones equivalente y bilateral o zigomorfa cuando los pétalos son de tamaño desigual y con una distribución equidistante entre ellos, lo cual permite dividir la flor en dos partes iguales.El receptáculo, el cáliz y la corola, juntos forman el perianto o envoltura protectora de la flor. AndroceoFormado por los estambres y constituyen el aparato sexual masculino. El estambre consta de un tallo o filamento, que lleva en su ápice una antena en donde se desarrollan los granos de polen.En el androceo, los estambres pueden estar libres (dalistémono) o soldados (gamostémono).Los estambres pueden ser todos iguales (isostémono), agruparse de dos en dos (didinamos) o en grupo de cuatro y otro de dos (tetradínamos). GineceoFormado por varios pistilos que constituyen el aparto sexual femenino de la flor.El pistilo o carpelo consta de tres partes: El ovario, el estilo y el estigma, que es rugoso y esponjoso con el fin de atrapar el polen.Los carpelos pueden presentarse separados o estar soldados entre sí parcial o totalmente.El ovario contiene los óvulos, cada óvulo contiene un saco embrionario, dentro del cual crece la ovocélula. La posición del ovario puede ser superada por encima de la inserción de los demás verticilios florales como en el nabo, tomate, ciruela, durazno, o infera por debajo de esta inserción.

144

Plantas monóicas y dióicas Las plantas pueden ser dióicas cunado poseen flores de un solo sexo, femeninas o masculinas unisexuales, ejemplo: papayo, joroba o fresno el inchi.Cuando la misma planta posee flores femeninas y masculinas, ejemplo: maíz y nogal, se denomina monoica. Fórmula floral Permite resumir las características de una flor, para tal fin se utilizan símbolos, letras y números, los cuales se describen con una determinada secuencia así: 1. Simetría: La cual puede ser actinomorfa simbolizada con un asterisco zigomorfa representada con una flecha invertida

,o

2. Sexo: Si la flor es unisexual se representa su sexo así:

3. Cáliz: Se presenta con la letra C seguida del número de sépalos. En el caso de que los sépalos sean soldados (gamosépalos) el número de sépalos se encierra en un paréntesis, ejemplo: C(5). 4. Corola: Se simboliza con la letra K seguida del número de pétalos. Si los pétalos son unidos o soldados (gamopétala) el número de pétalos se encierra en un paréntesis K(5) si los pétalos son libres el número de pétalos va sin paréntesis K5. 5. Androceo: Se representa por la letra A seguida del número de estambres, si son libres se representa sin paréntesis A5 si los estambres son soldados el número de estos va dentro de un paréntesis A(5). Pueden representarse de acuerdo a su agrupación A2+2. 6. Gineceo: Se representa con la letra G indicando la posición del ovario con una raya pequeña así: si es inferior la raya va debajo de la letra (G) si es superior la raya va encima de la letra (G). Seguida del número de carpelos o pistilos, el cual va sin paréntesis si son libres o dentro de un paréntesis si los carpelos son soldados G(5).

145

Ejemplo:

Inflorescencia En la mayoría de las plantas no se forma una sola flor en el ápice del tallo o en la axila de una hoja, sino que en una rama o planta se desarrollan arreglos de pequeñas flores, denominadas inflorescencias. Las inflorescencias pueden clasificarse en Racemosas, cimosas y compuestas. 1. Racemosas: Tienen crecimiento centrípeto y pueden ser: - Racimo: Presenta un eje principal alargado y flores pediceladas en toda su extensión. - Umbela: De un punto del pedúnculo parten pedicelos como radios. - Corimbo: Tiene un eje principal a lo largo del cual salen pedicelos permitiendo a las flores estar en un mismo nivel. - Espiga: Del pedúnculo o eje salen flores sésiles. - Capítulo o cabezuela: De un eje ensanchado salen flores sésiles. 2. Cimosas: Su crecimiento es centrífugo, definido y pueden ser: - Monocasio: Formado por una flor principal terminal y otra lateral secundaria. - Helicoidea: Con un eje prolongado y flores a ambos lados. - Dicasio: Con una flor lateral y dos secundarias laterales. - Escorpioidea: Con flores a un solo lado y eje curvado o enmallado.

146

Las inflorescencias también pueden formarse por la modificación o la combinación de dos inflorescencias simples. Ejemplo: racimo de racimos, racimos de espigas, umbela de capítulos. El fruto y la semilla Después del proceso de fecundación, el ovario maduro con o sin partes asociadas se convierte en fruto.La pared del ovario junto con las partes asociadas (si se tienen) se convierte en pericarpio o partes protectoras que rodean la semilla.Al madurar el pericarpio puede contener sustancias de reserva que constituyen la pulpa en frutos carnosos. En otros frutos el pericarpio es seco.La semilla es el óvulo maduro, y contiene el embrión y las sustancias alimenticias necesarias para su desarrollo y crecimiento.En las ginospermas la semilla se desarrolla en la superficie de las escamas de los conos, en las angiospermas la semilla se desarrolla dentro de la pared protectora del ovario.Las sustancias alimenticias se encuentran en el endosperma o en el mismo embrión en las dicotiledóneas, en monocotiledóneas se ubica en el albumen. Clasificación de frutos según Fuller y otros (Botánica, Editorial Interamericana) 1.Frutos simples: El fruto simple consta de un solo ovario madurado. Las clases principales de frutos simples son: a) Frutos carnosos:Pericarpio blando y carnoso en el momento de la madurez. Las semillas escapan de los frutos carnosos como resultado de la descomposición de los tejidos carnosos. Baya: Pericarpio totalmente carnoso, ejemplo: Uva, banano, tomate, papaya, sandía, guayaba, naranja, pepino, pimentón. Drupa: el exocarpio es una capa delgada, el mesocarpio es grueso y carnoso, el endocarpio es duro y pétreo, ejemplo: melocotón, coco, aceituna, cereza, albaricoque. b) Frutos secos: Pericarpio seco, quebradizo y duro en la madurez, contiene varias semillas. Frutos deshiscentes: Se abren en forma natural para liberar las semillas, ejemplo: arveja, fríjol, habichuela, magnolia, lirio, tulipán, violeta. Frutos indehiscentes: No se abren al llegar la madurez contienen una o dos semillas.

147

Frutos agregados: Es un racimo de varios ovarios madurados, producidos por una sola flor y llevados en el mismo receptáculo. Ejemplo: frambuesa y zarzamora. Frutos múltiples: Racimos de muchos ovarios madurados producidos por varias flores amontonadas en la misma inflorescencia, ejemplo: mora y piña, higuera. Frutos accesorios: Frutos que constan de uno o más ovarios madurados, con tejidos de otras partes florales, como el cáliz o el receptáculo. En un fruto accesorio, estos tejidos complementarios están a menudo muy desarrollados, hasta constituir la parte principal de la estructura designada popularmente “fruto”, entre los frutos accesorios familiares figura n las fresas. en la que los frutos individuales son aquenios, llevados a un receptáculo suculento, rojo, dulce, extensamente desarrollado. Otro tipo de fruto accesorio es el pomo ejemplificado por manzanas y peras, en que los ovarios maduros están rodeados de tejido de receptáculo y cáliz agrandado, en los que están almacenadas grandes cantidades de alimento y agua. En la tabla siguiente se resume la función que realiza cada uno de los órganos que conforman la planta Órgano Raíz

Tallo

Función Fijación de la planta al suelo Absorción de agua y minerales del suelo En algunas plantas son órganos de almacenamiento como en la zanahoria y la yuca Conecta la raíz y las hojas Conduce agua y sales minerales de la raíz a las hojas Conduce sustancias elaboradas de las hojas a la raíz En algunas plantas son órganos de almacenamiento como en la papa y la cebolla cabezona Puede servir para la reproducción vegetativa de algunas plantas.

Hoja

Fotosíntesis o producción de alimento Respiración de la planta a través de estomas Transpiración

Flor

Formación de semillas Reproducción sexual de la planta Almacenamiento como en el brócoli, el coliflor

Fruto

Guardar y proteger las semillas Almacenamiento de sustancias alimenticias Contener el embrión de la nueva planta Reservar sustancias alimenticias para el desarrollo y crecimiento del embrión

Semilla

148

Lección 15 Los Microorganismos Introducción La microbiología estudia los microorganismos u organismos unicelulares generalmente microscópicos que se dividen en: virus; bacterias; protozoos, algunas algas y hongos.Según el objeto de estudio o de interacción entre el hombre y los microorganismos se pueden señalar múltiples clasificaciones para casos específicos de la microbiología. Por ejemplo: bacteriología, microbiología agrícola, microbiología de alimentos, microbiología ambiental, protozoología, micología, virología, entre otras. El objeto material de la microbiología viene delimitado por el tamaño de los seres que investiga, lo que supone que abarca una enorme heterogeneidad de tipos estructurales, funcionales y taxonómicos: desde partículas no celulares como los virus, viroides y priones, hasta organismos celulares tan diferentes como las bacterias, los protozoos y parte de las algas y de los hongos, los cuales según la clasificación de Whittaker conforman reinos distintos a plantas y animales. Los Virus Características Los virus son organismos submicroscópicos, de forma variable pueden ser alargados, icosaédricos (polígono de 20 lados), algunos como los bacteriófagos que atacan a las bacterias, tienen forma más compleja su estructura presenta cabeza y cola. Los virus contienen solamente un tipo de ácido nucleico que puede ser: ADN (ácido desoxirribonucleico) o ARN (ácido ribonucleico), rodeado de una cubierta de proteína denominada cápsida la cual tiene función protectora.

Figura 108Microfotografía de Adenovirus

Tomada de http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookDiversity_1.html http://web.uct.ac.za/depts/mmi/stannard/linda.html

149

Algunos tipos de virus poseen también una envoltura, constituida por lípidos y proteínas, que tiene su origen en la membrana de la célula infectada y envuelve la cápsida, es el caso del virus de inmunodeficiencia humana. A esta estructura completa se la denomina partícula vírica o virión.Los virus no tienen organización celular, ni pueden realizar sus procesos metabólicos de manera independiente, por lo que se les sitúa en el límite entre lo vivo y lo no vivo.Para su replicación necesitan de células vivas constituyéndose en parásitos intracelulares obligados. Los virus pueden actuar de dos formas distintas: • Como agentes infecciosos productores de enfermedades en el hombre, las plantas y los animales. Se reproducen en el interior de las células que infectan de donde obtienen todo el material y los mecanismos requeridos para su replicación. • Como agentes genéticos que modifican el material hereditario de las células que infectan, al unirse a su material genético y causar variabilidad genética. Los virus que infectan a las bacterias se denominan bacteriófagos

Figura 109Representación esquemática de un virus bacteriófago Fuente: Carmen Eugenia Piña

Figura 110Representación esquemática de bacteriófago infectando una bacteria Fuente: Carmen Eugenia Piña

150

Mecanismo de replicación de los virus El proceso se inicia con la adhesión del virus a la célula El virus penetra dentro de la célula e inyecta en ella su ácido nucleico (material genético). El ADN de la célula fabrica las proteínas víricas y el ácido nucleico viral se replica en la célula que parásita utilizando las enzimas, el material y los mecanismos de la célula que hospeda. Cuando hay suficiente cantidad de ácido nucleico viral este se ensambla con la proteína vírica y abandona la célula. Clasificación de los virus Los virus no se clasifican en ninguno de los 5 reinos propuestos por Whittaker debido a que no tienen organización celular, y utilizan los procesos anabólicos de las células hospedadoras para su replicación. Tampoco se ubican en ninguno de los 3 dominios El ICTV (Comité Internacional de Taxonomía de Virus) propuso un sistema universal de clasificación viral. El sistema utiliza una serie de taxones como se indica a continuación: Orden (-virales). Familia (-viridae) Subfamilia (-virinae) Genero (-virus) Especie ( ). Los virus se agrupan en familias y subfamilias cuyo nombre se ha latinizado; por ejemplo, los virus herpes se agrupan en la familia Herpesviridae. Las subfamilias tienen el sufijo “nae”, Ej: Herpesvirinae. El otro tipo de agrupación es el género, que no se nombra en forma latinizada, por ejemplo, herpesvirus. Por ejemplo, el virus Ebola de Kikwit se clasifica como: Orden: Mononegavirales Familia: Filoviridae Género: Filovirus Especie: virus Ebola Zaire

151

Los

criterios

utilizados

en

este

sistema

de

clasificación

son:

a) Tipo y naturaleza del genoma. (AND; ARN) b) Morfología de la partícula vírica o virion: simetría de la nucleocápsula, presencia de envoltura. c) Mecanismo de replicación Hospedero Otro sistema de clasificación se basa en la capacidad de infectar determinadas células huésped y de acuerdo con ello se subdividen en tres clases principales: virus animales, virus bacterianos o bacteriófagos y virus de las plantas Origen de los virus Existen 2 hipótesis sobre el origen de los virus: http://bibliotecadigital.ilce.edu.mx/sites/ciencia/volumen2/ciencia3/071/htm/sec_18.htm

1. Una teoría propone que los virus son consecuencia de la degeneración de microorganismos (bacterias, protozoarios y hongos) que alguna vez fueron parásitos obligatorios de otras células, a tal grado que se convirtieron en parásitos intracelulares y perdieron paulatinamente todos los componentes necesarios para desarrollar un ciclo de vida libre independiente de la célula hospedera. Sin embargo, el hecho de que la organización de los virus es de tipo no celular, es un importante argumento en contra de esta teoría, ya que las cápsides virales son análogas, desde el punto de vista morfogenético, a los organelos celulares constituidos por subunidades de proteína, tales como flagelos y filamentos que forman el citoesqueleto, y no son parecidas a las membranascelulares.Por otra parte, las envolturas de los virus no muestran similitudes arquitectónicas con las membranas celulares o en caso de poseer dicha arquitectura es debido a que la envoltura viral fue adquirida como consecuencia de la protrusión o brote de la partícula viral a través de la membrana celular. 2. La otra teoría propone que los virus son el equivalente a genes vagabundos. Por ejemplo, es probable que algunos fragmentos de ácido nucleico hayan sido transferidos en forma fortuita a una célula perteneciente a una especie diferente a la que pertenecen dichos fragmentos, los cuales en lugar de haber sido degradados (como ocurre generalmente), por causas desconocidas podrían sobrevivir y multiplicarse en la nueva célula hospedera. Enfermedades virales Los virus son causantes de enfermedades infecciosas en el hombre como son : la viruela, la gripe, la hepatitis, las paperas, la rabia, la poliomielitis, el SIDA, el

152

sarampión , la encefalitis, la rubéola, el herpes, la fiebre amarilla ésta última transmitida por un vector; en los animales originan el moquillo, la rabia, la influenza, la encefalitis, el cólera; y en las plantas enfermedades como el virus del mosaico del tabaco y el virus del mosaico amarillo del nabo entre otras. Los mecanismos de trasmisión son diversos algunos por vía respiratoria cuando la persona enferma estornuda o tose; otros a través de picaduras de insectos es el caso de la fiebre amarilla; o por mordedura de animales enfermos como en el caso de la rabia; los que causan trastornos digestivos por vía oral-fecal y por inoculación con jeringas u objetos infectados, por transfusión de sangre contaminada, por relaciones sexuales sin protección y por último a través de la madre al hijo durante el embarazo o en el momento del parto. En el caso de las plantas la trasmisión se hace por insectos o nematodos.Los medios para prevenir la infección viral son las vacunas que causan inmunidad, evitar el contacto con personas infectadas, esterilización de objetos, uso de jeringas desechables. Importancia biológica de los virus Los virus sirven para adelantar investigaciones biológicas relacionadas con su mecanismo de replicación y así poder encontrar mecanismos para controlar su multiplicación. Los virus permiten la elaboración de vacunas, fueron de los primeros modelos para el estudio del funcionamiento del genoma, los biólogos utilizan los virus para estudiar el mecanismo de control de la información genética y extrapolarlo a organismos más complejos. Algunos virus atacan bacterias e insectos perjudiciales ayudando a mantener el equilibrio ecológico.Los virus sirven como mediadores en el intercambio genético entre individuos de una misma o diferentes especies proporcionando variabilidad de los organismos y por ende disminuyen la susceptibilidad a ser infectados. Por ejemplo, las bacterias que han sido infectadas por virus –bacteriófagos- pueden realizar funciones que en otras condiciones no podría realizar Algunos virus se utilizan en medicina para introducir información a células animales que presenten defectos genéticos o adquiridos y así lograr que funcionen normalmente. Viroides Son moléculas de ARN circular (300-400 nucleotidos) que carecen de cubierta viral o cápsida, son de tamaño menor que los virus. Se encuentran en células vegetales donde causan enfermedades. Debido a que los viroides no codifican para ninguna proteína deben necesariamente reclutar proteínas y vías metabólicas de la célula hospedera para completar su ciclo infeccioso. Se les considera como la etapa primitiva de los virus. Se cree que los viroides podrían proceder evolutivamente de los intrones.

153

Características 1. Bajo peso molecular 2. No tienen cápsula proteica 3. Se multiplican en forma autónoma 4. Parásitos obligados 5. Infecciosos Priones Son proteínas que se multiplican en la célula hospedadora donde generan graves alteraciones. Todas las enfermedades ocasionadas por priones son neurológicas, por ejemplo el síndrome de las vacas locas. A continuación se presenta una ampliación tomada de: http://enfenix.webcindario.com/biologia/microbio/priones.phtml Proteínas del PrionLos priones son agentes patógenos formados por una proteína (proteína del prión o PPr).Los priones, o las enfermedades producidas por priones, tienen un comportamiento sorprendente, por un lado se transmiten verticalmente, como cualquier enfermedad hereditaria típica, mientras que por otro lado se comportan de manera infectiva, transmitiéndose horizontalmente, mediante contagios que pueden darse entre individuos de distintas especies. La proteína del prión (PrP) normal, tiene una secuencia de aminoácidos, (estructura primaria) idéntica a la proteína del prión patógena. La diferencia entre las dos recae en la estructuras secundaria y terciaria

Proteína de Prion Normal

Proteína de Prion patógeno

154

Proteína patógena infectando una normal

Interacción de proteína normal con proteína patógena

Estructura terciaria de la proteína del prión

Estructura secundaria del Prion

La proteína normal es muy rica en hélices alfa , la proteína patógena lo es en láminas beta . Este cambio de configura ción es crucial, ya que las proteínas con láminas beta son muy resistentes a las enzimas proteolíticas, al calor y no se disuelven en agua. Pero sobre todo, la proteína alterada tiene una característica única: interacciona con una molécula de proteína normal, le cambia la conformación y la hace capaz de convertir las estructuras de más proteínas normales. Ahí radica al parecer, el poder infectivo de los priones

155

Esquema explicativo poder infectivo de los Priones

Figura 111 Esquema explicativo poder infectivo de los Priones

Puede ocurrir que la proteína patógena infecte individuos que producen proteína normal (a), como ha ocurrido por ejemplo al consumir las vacas piensos elaborados a partir de ovejas enfermas. En este caso la proteína patógena origina un cambio conformacional de la proteína normal (b), transformando las hélices alfa de su estructura proteica en láminas beta. Las nuevas proteínas patógenas inducen el cambio en otras normales, lo cual produce un efecto de "cascada". Para saber más Profundización sugerida para estudiantes de Regencia de Farmacia, Zootecnia, e Ingeniería de Alimentos. Curso sobre Virología de la Universidad de Rochester: http://www.medynet.com/usuarios/nnuneza/virologia/indexviral.html http://www.virology.net/ Journal sobre virología

156

Lectura Nuevas investigaciones confirman el origen vírico de la obesidad El 30% de los casos pueden deberse a infecciones y una vacuna puede prevenir hasta el 15% del sobrepeso Nuevas investigaciones confirman que el 30% de los casos de obesidad son debidos a infecciones víricas y que una vacuna puede reducir el crecimiento de la enfermedad en un 15%. Lo que en 1997 se descubrió en animales y el año pasado en humanos, se confirma plenamente ahora: el adenovirus Ad-36 desempeña un papel crucial en la obesidad humana, originando hasta 20 kilos de más en las personas infestadas. En consecuencia, de la misma forma que se previenen enfermedades como la rubéola o la polio, una protección similar aplicada en la infancia evitaría que los niños desarrollasen el sobrepeso en la edad adulta. Por Marta Morales. Cierto tipo de obesidad, derivada de un virus, podría evitarse por medio de vacunas, según el equipo médico que lleva investigando la posible relación de la obesidad con un tipo de virus y que ha informado del estado de sus conocimientos en el congreso de la NAASO norteamericana, una asociación líder en investigación científica sobre la obesidad, celebrado la pasada semana en Vancouver. El investigador Nikhil V. Dhurandhar, del Centro de Investigaciones Biomédicas de Pennington, Lousiana, Estados Unidos, afirmó en Vancouver que el exceso de peso está relacionado, en ciertos casos, con infecciones virales. Explicando el estado actual de sus investigaciones, que ya fueron objeto de un estudio publicado recientemente por el International Journal of Obesity, Dhurandhar señaló que se ha comprobado que el adenovirus 36 (Ad-36) estaba presente seis veces más en los obesos que en las personas de peso normal. Hasta ahora se han identificado al menos 40 subtipos de adenovirus que pueden provocar problemas respiratorios e infecciones gastrointestinales. Según el profesor Dhurandhar, sus investigaciones demuestran que el Ad-36 desempeña un papel crucial en la obesidad humana. En el estudio publicado en el International Journal of Obesity, que analizó a 502 personas, demostró que el 30 por ciento de ellas presentaban anticuerpos del virus Ad-36, mientras que los mismos anticuerpos estaban presentes únicamente en el 5 por ciento de las personas no obesas. El estudio reveló asimismo que los obesos infestados con el Ad-36 pesan una media de 20 kilos más que las demás personas investigadas. Estos obesos se distinguen además de los otros en que, paradójicamente, tienen una tasa más baja de colesterol y de triglicéridos. Los

157

investigadores consideran que el Ad-36 afecta al metabolismo de las células adiposas en crecimiento, favoreciendo la acumulación de grasa y su rápido crecimiento. Eso significa que una persona infestada por el virus engorda mucho más que otra persona que coma la misma cantidad y tipo de alimentos. Dhurandhar considera que el exceso de peso está relacionado, en ciertos casos, con infecciones virales. En consecuencia, de la misma forma que se previenen enfermedades como la rubéola o la polio, señala que una protección similar aplicada en la infancia evitaría que los niños desarrollasen el sobrepeso en la edad adulta. Dhurandhar está especializado en la investigación de las relaciones entre los virus y la obesidad, y ha desarrollado su propia teoría acerca de lo que ha bautizado como el “virus de la obesidad”, perteneciente al grupo de los llamados adenovirus. Virus identificado Los adenovirus son virus de tamaño mediano, de los que existen 49 tipos agrupados en seis subgéneros (de la A a la F). Generalmente estables contra agentes químicos o físicos, los adenovirus pueden sobrevivir durante un tiempo prolongado fuera del cuerpo. Sus efectos más comunes en el organismo humano son las enfermedades respiratorias, pero también producen gastroenteritis, conjuntivitis, cistitis y sarpullidos. Uno de estos adenovirus es capaz además de producir obesidad. Las investigaciones de Dhurandhar han demostrado que existe una relación entre la grasa que genera el cuerpo y la presencia de los anticuerpos del AD-36 en la sangre. Investigaciones previas ya habían demostrado que ratones y monos a los que se les había inyectado dicho virus ganaban peso rápidamente. Hasta ahora se sabía que la obesidad está relacionada con múltiples factores. Aunque a menudo vaya asociada a un consumo excesivo de alimentos o a un tipo de vida sedentaria, el caso es que también existen otras causas, como la herencia genética, el contacto con los contaminantes o la ingesta de medicamentos. Evitar graves riesgos Los riesgos que para la salud entraña la obesidad son múltiples. Además de la muerte, el sobrepeso propicia un gran número de enfermedades crónicas como la diabetes, la hipertensión, el exceso de colesterol en la sangre, los infartos cerebrales, los problemas cardiacos (varios estudios han demostrado que por cada kilogramo de sobrepeso aumenta en un 1% el riesgo de muerte por enfermedades coronarias), el cáncer (principalmente de colon en hombres y mujeres, de recto y de próstata en hombres, y de útero y pecho en mujeres). Otras

158

enfermedades derivadas del exceso de peso serían la artritis y los problemas respiratorios. El Dr. Dhurandhar comenzó a interesarse en los casos virales de la obesidad en los años 80, mientras trabajaba como médico en Bombay, en la India. Allí pudo constatar que ciertos agentes patógenos provocan un rápido aumento del peso en algunosanimales después de ser infestados con el Ad-36. La NAASO norteamericana ofrece en su web la posibilidad de calcular la masa corporal. Por su parte, la empresa Obetech ofrece la posibilidad de descubrir si una persona está infestada por el Ad-36. La obesidad mata cada año en Estados Unidos a 300.000 personas y los descubridores del origen vírico de la obesidad consideran que el AD-36 tiene infectada al 20% de la población norteamericana. Una vacuna podría prevenir el 15% de los casos de obesidad, según sus estimaciones. Cirugía peligrosa La divulgación de los avances en esta investigación coinciden con la publicación de otros estudios en Estados Unidos que desvelan que los riesgos de morir como consecencia de la cirugía aplicada a la reducción de peso son mayores de lo que se pensaba, incluso entre las personas con sobrepeso que están entre los 30 y 40 años de edad. Hasta ahora se pensaba que la tasa de mortalidad en esta categoría de edad, la más susceptible de sufrir una cirugía para reducir el sobrepeso, era del uno por ciento. Sin embargo, un nuevo estudio revela que entre los 35 y los 45 años de edad, la muerte se lleva al 5 por ciento de los hombres y al 3 por ciento de las mujeres que han sufrido este tipo de intervenciones quirúrgicas. Los porcentajes de mortandad se elevan en los pacientes que tienen entre 45 y 54 años de edad. La posible vacuna contra la obesidad y el descubrimiento de los riesgos quirúrgicos, pueden provocar un giro en los comportamientos asociados a esta enfermedad. El número de estadounidenses que recurrieron a la cirugía para reducir su peso se multiplicó por cinco entre 1998 y 2002. Según un estudio de la Agencia para la Investigación y Calidad de la Sanidad (AHRQ), mientras que en 1998 sólo 13.386 estadounidenses recurrieron a la cirugía bariátrica, en 2002 la cifra ascendió hasta los 71.733, debido en gran parte a un aumento del 900 por ciento en las operaciones en pacientes con edades entre los 55 y 64 años. Written by Marta Morales on miércoles 19 Octubre 2005

159

Para saber más Profundización sobre virología http://www.virology.net/

Las Arqueobacterias y Bacterias Introducción Carl Woese mediante la secuenciación de la molécula de ARNr, comprobó que los procariotas pertenecientes al reino Mónera se dividían en 2 grupos o dominios: al primero de ellos lo llamó Eubacteria o Bacterias verdaderas y comprende las bacterias más comunes que habitan en el cuerpo de los seres vivos, suelo, aire y agua e incluye las Cianobacterias o algas verdeazules, con capacidad de realizar fotosíntesis. Poseen además de la clorofila un pigmento azul llamado ficocianina. Las cianobacterias se utilizan como indicadoras de polución orgánica. Las bacterias o eubacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Son procariotas, unicelulares de organización muy sencilla. Se estima que existen unas 1700 especies. El segundo grupo lo llamó Arqueobacteria o Arquea e incluye las bacterias que pueden crecer en condiciones extremas como los hielos antárticos psicrófilas, o en aguas muy hirvientes son las arqueas llamadas termófilas extremas, o las que habitan en medios anaerobios, con pH muy ácido, las bacterias productoras de gas metano y las que se desarrollan en medios salinos o sea las halobacterias. Algunas arqueas son habitantes del intestino del hombre y animales

Características de las Arqueas Forma de las Arqueas Presentan formas similares a la de las bacterias verdaderas: esféricas, individuales o en grupo, bacilares, filamentosas, lobuladas Estructura de Arquea Pared Celular semejante a la pared celular de las bacterias gram negativas. Formada por formada por lípidos, proteína o glicoproteína a diferencia de la pared celular de peptidoglucano de las eubacterias. La pared presenta simetría hexagonal y adquiere diferentes morfologías como respuesta a los diferentes ambientes en los cuales se desarrolla.

160

Membrana Plasmática puede presentar invaginaciones o mesosomas parecidos a los de las bacterias gram positivas. Carecen de ácidos grasos y en su lugar tienen cadenas laterales compuestas de unidades repetitivas de isopreno unidas por enlaces éter al glicerol que constituyen el gliceroldiéter cuando se distribuyen a manera de bicapa y el gliceroltetraéter cuando es a manera de monocapa, este último arreglo es muy estable a temperaturas altas por lo tanto, no es una sorpresa que se encuentre principalmente en las arqueas termoacidófilas. Protoplasma (citoplasma), separado en cromoplasma (periférico y pigmentado) y centroplasma (central, granuloso e incoloro). Los pigmentos que se encuentran en el citoplasma son: clorofila a, c, carotenoides, phycoxantina, ficocianina C, de color azul, ficocianobilina, ficoeritrina C, de color rojo, ficoeritrobilina entre otros. Nucleoplasma contiene el ADN puede aparecer en forma de pequeños gránulos, pueden aparecer granos de volutina, cianoficina y ribosomas.El ARN y enzimas de arqueobacterias son diferentes al de las bacterias verdaderas. Las arqueóbacterias presentan además mecanismos de defensa contra las condiciones extremas que podrían afectarlas. Por ejemplo ellas fabrican una variedad de moléculas y enzimas protectoras. Las arqueas que viven en medio ambiente altamente ácidos, poseen en su superficie celular unas moléculas cuya función es ponerse en contacto con tomado de: el ácido para evitar que penetre en la célula y así http://www.latinoseguridad.com/ LatinoSeguridad/Fenat/Arqueas.shtml evitar que el ADN se destruya. Las arqueas halófilas toman del exterior sustancias como el cloruro de potasio para equilibrar el interior de la célula y evitar que el agua salada penetre y destruya la célula. Se pueden encontrar en algunos tipos de alimentos en los que se han utilizado altas concentraciones de sal (salmueras) para su preservación como es el caso de pescados y carnes, en donde se reconoce su presencia porque forman manchas rojas. Las arqueas obtienen energía a partir de compuestos como hidrógeno, dióxido de carbono y azufre. Algunas lo hacen a partir de la energía solar a través de la bacteriorodopsina, un pigmento que reacciona con la luz y permite que la arqueobacteria fabrique el ATP. Eubacterias - Las cianobacterias

161

Las cianobacterias conocidas comúnmente como algas verde-azuladas por su color verde-azulado (a veces rojizo, pardo o negro). Se caracterizan por que son procariotas (sin núcleo verdadero), autótrofos (fundamentalmente). Unicelulares, tamaño entre 1 µm hasta varios micrómetros. La reproducción en las cianobacteriaas puede ser asexual, por bipartición, o por fragmentación de filamentos Algunas experiencias parecen confirmar que existen fenómenos que implican la recombinación de material genético, al igual que en las bacterias. Los géneros Oscillatoria, Spirulina y Rivularia presentan movimiento

Importancia biológica de cianobacterias http://www.eez.csic.es/~olivares/ciencia/fijacion/cianobacterias.htm Las cianobacterias son organismos antiguos que se caracterizan por conjugar el proceso de la fotosíntesis oxigénica con una estructura celular típicamente bacteriana. Al ser responsables de la primera acumulación de oxígeno en la atmósfera, las cianobacterias han tenido una enorme relevancia en la evolución de nuestro planeta y de la vida en él. En la actualidad presentan una amplia distribución ecológica, encontrándose en ambientes muy variados, tanto terrestres como marítimos, e incluso en los más extremos, siendo la fotoautotrofia, con fijación de CO2 a través del ciclo de Calvin, su principal forma de vida, y contribuyendo de manera importante a la productividad primaria global de la Tierra. En relación con esto, es también relevante el hecho de que muchas cianobacterias sean capaces de fijar el nitrógeno atmosférico, siendo, a su vez, capaces de hacerlo en condiciones de aerobiosis (de hecho, ciertas cianobacterias representan los mayores fijadores en amplias zonas oceánicas contribuyendo de forma importante a la cantidad total de nitrógeno fijado en vida libre).

162

Cianobacterias y fijación de nitrógeno La existencia conjunta de la fotosíntesis y de la fijación de nitrógeno ha requerido el diseño de estrategias que hagan posible el funcionamiento de ambos procesos antagónicos desde el punto de vista de sus requerimientos ambientales. Entre tales estrategias la separación en el tiempo o en el espacio de ambas funciones permite el desarrollo normal de la célula en condiciones de bajos niveles de nitrógeno combinado. En este sentido, merece particular mención la capacidad de algunas especies filamentosas de desarrollar unas células llamadas heterocistos, enormemente especializadas en la fijación del nitrógeno en ambientes aeróbicos. Los heterocistos son células especializadas, distribuidas a lo largo o al final del filamento (cianobacterias multicelulares filamentosas), los cuales tienen conexiones intercelulares con las células vegetativas adyacentes, de tal manera que existe un continuo movimiento de los productos de la fijación de nitrógeno desde los heterocistos hacia las células vegetativas y de los productos fotosintéticos desde las células vegetativas hacia los heterocistos (Todar, 2004). Las bases moleculares del proceso de diferenciación de los heterocistos y el establecimiento del patrón de distribución de los mismos en el filamento cianobacteriano constituyen uno de los campos más activos en el estudio actual de las cianobacterias y, asimismo, representa un modelo simple de establecimiento de patrones espaciales de diferenciación cuyo estudio puede abordarse con la gran variedad de herramientas desarrolladas para el análisis genético-molecular de las cianobacterias, que incluyen la construcción de especies y la disponiblidad de la secuencia completa de los genomas de varias de ellas. Muchas cianobacterias, por ejemplo, Anabaena azolla juegan un papel importante en el desarrollo de cultivos como el arroz. Anabaena azollae , en simbiosis con helechos , proporciona hasta 50 kg de nitrógeno/ha siendo la utilización de este sistema fijador general en muchas regiones del sudeste asiático. (Con la contribución de Antonia Herrero, Instituto de Biología Vegetal y Fotosíntesis, CSIC.) Las Bacteriaso eubacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Son procariotas, unicelulares de organización muy sencilla.

163

Figura 112Representación esquemática de una bacteria fuente: Carmen Eugenia Piña López

Características El tamaño microscópico de las bacterias está determinado genéticamente, y depende de la cepa, de las condiciones ambientales (nutrientes, sales, temperatura, tensión superficial). La unidad de medida bacteriana es el micrómetro, que equivale a 1/1000 milímetros (10-3 mm) = 1 micrómetro). Para darse una idea de su tamaño se calcula que en un centímetro cúbico cabe alrededor de un millón de billones de bacilos de tamaño medio. El rango en el tamaño de las bacterias es muy variado, existen bacterias como las nanobacterias de aproximadamente un 0.05 m m, o bacterias de un tamaño mayor como Epulopiscium , un comensal del intestino del pez cirujano que mide 0.5 mm. Algunos micoplasmas tienen tamaños que oscilan entre 0.2 a 0.3 micrómetros (mm) de diámetro Escherichia coli habitante natural en el intestino humano mide aproximadamente 0.5 m m de ancho por 2 m m de largo. Las bacterias difieren en la forma, las hay esféricas u ovales llamadas cocos, alargadas cilíndricas en forma de bastón se les denomina bacilos, en forma de espiral o helicoidal, los espirilos, en forma de coma las llamadas vibrios y algunas en forma cuadrada con lados y esquinas en ángulo recto. La forma de la bacteria puede ser modificada por las condiciones ambientales. Composición Las bacterias están constituidas por un 70% de agua y un 30% de materia seca, de esta materia seca el 70% corresponde a proteínas, el 3% a ADN, el 12% a ARN, el 5% a azucares, el 6% lípidos y el 4% a minerales Estructura de las bacterias: Dentro de este grupo se encuentra la pared celular, los flagelos, esporas, fimbrias o pelos y cápsula. Estas estructuras no siempre se

164

encuentran en todas las bacterias, por lo tanto se consideran variables, razón por la cual se estima que no son esenciales. La célula bacteriana consta de: *Pared celular: es una estructura rígida, se encuentra rodeando la membrana citoplasmática de casi todas las bacterias, posee una gran rigidez lo cual le confiere gran resistencia. Se considera esencial para el desarrollo y división bacteriana; cumple con dos funciones importantes: mantener la forma de la célula y evitar que la célula colapse debido a las diferencias de presión osmótica por el constante intercambio de fluidos. El grosor de la pared de las bacterias oscila entre de 10 y 80 nanómetros. La pared celular constituye una porción apreciable del peso seco total de la célula; dependiendo de la especie y de las condiciones de cultivo puede representar del 10 al 40 por ciento del peso seco del organismo. En las eubacterias la pared celular contiene peptidoglicano, compuesto que no se encuentra en las células eucariotas. En las bacterias gram- positivas se halla inmerso en una matriz aniónica de polímeros azucarados, mientras que en las bacterias gram-negativas está rodeada por una membrana externa, e inmersa en un espacio periplásmico. El prefijo gram proviene de la técnica de coloración que se utiliza para la diferenciación primaria del tipo de bacteria. Además de los compuestos anteriores, se encuentran el ácido diaminopimélico y ácido teicoico * Membrana plasmática la cual presenta invaginaciones, que son los mesosomas que contienen enzimas que participan en la duplicación del ADN, en la membrana plasmática se localizan también enzimas que intervienen en la producción de energía (ATP), función que en la célula eucariótica cumple la mitocondria. *Los mesosomas son repliegues y extensiones de la membrana citoplasmática, intervienen en procesos metabólicos y de reproducción de la célula bacteriana. * Citoplasma el cual presenta un aspecto viscoso, en él se encuentran: materiales de reserva , ARN, ribosomas, un nucleoide ubicado en su zona central donde se encuentra la mayor parte del ADN bacteriano en algunas bacterias se encuentran dispersos por el citoplasma fragmentos circulares de ADN con información genética llamados plásmidos y pigmentos fotosintéticos en el caso de bacterias fotosintéticas. En el citoplasma se realizan los procesos metabólicos de la célula bacteriana * Ribosomas son organelos con apariencia de gránulos, algunos se hallan dispersos en el citoplasma bacteriano y otros s e agrupan en cadena y se les denomina polirribosomas; están compuestos por ácido ribonucleico - ARN (60%) y proteína (40%). Su función es la síntesis de proteína.

165

*Los cuerpos de inclusión o gránulos son materiales de reserva como lípidos, hierro, azufre que se almacenan en el citoplasma, en los períodos de suficiente aporte nutricional para ser utilizados en épocas de inanición *Lasvesículas se encuentran en ciertas bacterias que habitan en lagos estas vesículas les sirven para flotar, contrarrestando la atracción gravitatoria, y así lograr el óptimo de luz * Laregión nuclear esta localizada centralmente en la célula, se compone principalmente de ADN aunque también puede encontrarse ARN y proteínas asociadas a éste. El ADN esta dispuesto en un cromosoma largo y circular, algunas veces llamado nucleoide, genóforo o cuerpo cromatínico. *Los plásmidos son pequeñas moléculas circulares de ADN extracromosómico, se encuentran en la región nuclear de algunas bacterias. Las moléculas de ADN plásmico a pesar de encontrarse fuera del cromosoma, toman una conformación de doble hélice al igual que el ADN de los cromosomas. Los plásmidos se replican de manera independiente al cromosoma y contienen información genética para la bacteria complementaria a la contenida en el nucleoide y que le es útil para su supervivencia en condiciones desfavorables. Por ejemplo el código que hace resistentes a las bacterias a los antibióticos, la capacidad de apareamiento, la resistencia y la tolerancia a los materiales tóxicos. Los plásmidos son muy utilizados en ingeniería genética ya que por su tamaño resulta fácil manipularlos; se pueden aislar, introducir en ellos información e introducirlos en otras células bacterianas viables en las cuales se expresa la información que ellos portan. * Flagelos presentes en la mayoría de bacterias, generalmente son rígidos, implantados en la membrana celular mediante un corpúsculo basal. Las bacterias que poseen flagelos tienen movilidad, o sea, el movimiento de traslación de un punto a otro en forma rápida y de zig zag permitiéndoles responder a estímulos por ejemplo: químicos cuando las bacterias son atraídas a determinados compuestos como la glucosa, la galactosa y se denomina quimiotactismo positivo o por el contrario son repelidas de algunos compuestos como los antibióticos, quimiotactismo negativo, luminosos es el caso de las bacterias fotosintéticas que tienen fototactismo positivo a los rayos luminosos. Los flagelos permiten a la mayoría de bacterias la movilidad en medios líquidos, una excepción son las bacterias deslizantes que se mueven por flexión de la pared celular. La movilidad debe distinguirse del movimiento pasivo de las bacterias en una sola dirección como consecuencia de las corrientes en la preparación, o del movimiento Browniano que es la constante vibración de las bacterias en un punto fijo comportamiento que se presenta por estar suspendidas en medio líquido y por su pequeño tamaño

166

* Fimbriaso pili muy numerosos y cortos, se encuentran relacionadas con diversas funciones como la de adherencia a las superficies de tejidos, sitios de adsorción para virus bacterianos y además pueden servir como pelos sexuales para el paso de ADN de una célula a otra, no tienen función de motilidad * Cápsula es una estructura de material viscoso que rodea la pared celular de muchas bacterias que se encuentran en su ambiente natural. La cápsula no cumple ninguna función metabólica pero sirve de protección, cuando una bacteria encapsulada invade a un huésped, la cápsula evita que los mecanismos de defensa del huésped destruyan la bacteria, permite la adhesión de bacterias hermanas para la formación de colonias, igualmente permite a las bacterias adherirse a sus sustratos. * Endosporas Son estructuras generalmente de forma esférica que se forman en ciertas bacterias gram positivas como respuesta a condiciones ambientales adversas (poca humedad, temperaturas extremas, agentes químicos y físicos etc.). Cuando las condiciones ambientales vuelven a ser favorables la endospora se transforma de nuevo a la forma vegetativa. Ciertas formas filamentosas pueden producir la endospora en el extremo del filamento y aparecen de manera libre, en otras bacterias como Clostridium se pueden observar en el interior de las bacterias a las que deforman de una manera característica, lo que sirve para su identificación

Reproducción Generalmente las bacterias se reproducen asexualmente por fisión binaria o bipartición, unas pocas por gemación, algunas especies de bacterias filamentosas se reproducen por esporas que se forman en los extremos de los filamentos. Durante la bipartición la célula bacteriana origina dos células iguales o clones. Este mecanismo de división celular es más rápido y menos organizado que la mitosis y la meiosis. El resultado de la fisión binaria son dos células hijas por cada célula madre, así, una célula se divide en dos, dos en cuatro y cuatro en ocho y así sucesivamente. La síntesis de la pared, el crecimiento bacteriano y la duplicación del ADN regulan la división celular. La bacteria da lugar a dos células hijas. La división empieza en el centro de la bacteria por una invaginación de la membrana citoplasmática que da origen a la formación de un septo o tabique transversal. La separación de las dos células va acompañada de la segregación en cada una de ellas de uno de los dos genomas que proviene de la duplicación del ADN materno. El proceso de división ocurre en tres fases principales: 1. elongación o alargamiento de la célula y duplicación del material genético o ADN, 2. separación de ADN dentro de las células hijas formadas y 3. la citocinesis o separación celular. El proceso se inicia con la duplicación del ADN, luego la pared

167

celular y la membrana plasmática forman un tabique que divide la célula bacteriana en dos como se ve en el siguiente esquema:

Figura 113Representación reproducción de una bacteria fuente: Carmen Eugenia Piña López

Intercambio genético en bacteriasSinembargo en algunas bacterias ocurren intercambios genéticos (intercambio de genes) como resultado de tres mecanismos: transformación, conjugación, transducción e intercambio de plásmidos. Transformación: Consiste en el intercambio genético producido cuando una bacteria es capaz de captar fragmentos de ADN, de otra bacteria que se encuentran dispersos en el medio donde vive. Animación sobre proceso de conjugación Conjugación: En este proceso, una bacteria donadora F+ transmite a través de un puente o pili, un fragmento de ADN, a otra bacteria receptora F-. La bacteria que se llama F+ posee un plásmido, además del cromosoma bacteriano.

168

Transducción: En este caso la transferencia de ADN de una bacteria a otra, se realiza a través de un virus bacteriófago, que se comporta como un vector intermediario entre las dos bacterias. Nutrición Las bacterias pueden ser autótrofas o heterótrofas. Las autótrofas utilizan la luz del sol y el bióxido de carbono o compuestos inorgánicos, por ejemplo, el azufre para fabricar su alimento. Las heterótrofas (por absorción) pueden utilizar fuente de carbono orgánico para su alimentación. Las bacterias pueden vivir como parásitos afectando los organismos donde habitan, como simbiontes formando parte de la flora bacteriana normal de la piel, cavidades y tracto digestivo del hombre y de los animales y saprofitas la gran mayoría, ayudando a la descomposición de la materia orgánica muerta. Clasificación de las Bacterias En la siguiente tabla se resumen algunos de los aspectos fundamentales en la clasificación de las bacterias

Por forma Por ordenamiento

Coco único

Coco (esférico) Diplocococo en parejas

Representación

Por composición de la pared celular que reacciona a la tinción de gram Gram negativas no retienen el cristal violeta conservan el colorante rojo por ejemplo safranina son susceptibles a las cefalosporinas Diplococo en parejas Gram positivas absorben y conservan el colorante cristal violeta son susceptibles a la penicilina y estreptomicina

169

Estreptococo en cadena

Estafilococo en racimo de uvas

Sarcina grupo de ocho cocos Tetracoco Grupo de cuatro cocos

Espirilos

En forma de espiral

Bacilos

En forma de bastón

Otro aspecto a tener en cuenta en la clasificación de bacterias es la necesidad de oxígeno para poder vivir, las bacterias que requieren de oxígeno para cumplir sus procesos vitales se denominan aerobias, mientras que las que viven en ausencia de oxígeno se llaman anaerobias. Utilidad de las bacterias Las bacterias son útiles: 

Para fijar el nitrógeno atmosférico que es tomado por las plantas y luego trasferido a los animales.

170



En la descomposición la materia orgánica muerta ayudando de esta manera a la fertilización del suelo. 

En la producción de algunos antibióticos.



En la producción de determinadas enzimas.



En la elaboración de productos lácteos como: queso, yogur , mantequilla



En la producción de vinagre.



En la producción de encurtidos.



En la depuración de aguas residuales.



En el curtido de cueros.



La Echerichia coli ha sido manipulada genéticamente para producir insulina

Enfermedades de origen bacteriano Las bacterias pueden ocasionar enfermedades, entre las bacterias más perjudiciales tenemos: 

La causante del tétano en caso de heridas contaminadas con Clostridium tetani, bacteria que afecta el sistema nervioso causando rigidez muscular y la muerte 

La que ocasiona la gangrena gaseosa o putrefacción de tejidos, órganos especialmente de las extremidades del hombre y de los animales siendo necesaria su amputación. 

La bacteria contaminante es un Clostridium que penetra en heridas o puede ser trasmitida por la ingestión de aguas contaminadas.  El bacilo de Koch o Mycobacterium tuberculosis que causa la tuberculosis cuando la persona enferma tose y en su esputo se libera el bacilo. 

El bacilo Salmonella typhi causante del tifo a través de alimentos contaminados con excretas. 

El bacilo Corynebacterium diphtheriae que produce una infección del sistema respiratorio, la difteria, que además lesiona el corazón y el sistema nervioso ocasionando la muerte. 

La espiroqueta Treponema pallidum. que produce una enfermedad de trasmisión sexual denominada sífilis.

171



La Brucella, bacteria que causa la brucelosis por contacto con ganado infectado, leche o carne contaminada y en la mujer provoca el aborto espontáneo. Para saber más http://www.ugr.es/~eianez/Microbiologia/programa.htm

Los Protozoos Características y clasificación Son organismos microscópicos unicelulares, eucarióticos, se encuentran en su mayoría en medios acuáticos, en el suelo húmedo aunque algunos son endoparásitos y otros ectoparásitos. La mayoría son heterótrofos, sin embargo algunos son autótrofos. Se reproducen por división binaria (la célula se divide en dos) tienen capacidad de locomoción o desplazamiento.Según la forma como se desplazan los protozoos se clasifican en: sacordinos, ciliados, flagelados y esporozoos.

Figura 114Caracteristica del paramecio

Sacordinos Se desplazan por medio de pseudópodos (falsos pies), que son prolongaciones de la célula que les sirven además para capturar el alimento,

172

englobarlo y formar una vacuola digestiva, donde el alimento es digerido por acción de enzimas.

Figura 115Entamoeba histolítica, Tomada de: http://hpd.botanic.hr/bio/odgovori/odgovor315.htm

Son representantes de este filo: - La ameba causante de infección del intestino o del hígado (amebiasis) por la ingestión de aguas o alimentos contaminados con heces. - La Entamoeba histolítica, que produce la disentería, enfermedad propia de los países tropicales y que produce unas diarreas muy intensas. - Los foraminíferos componentes del plancton (con un caparazón por cuyos orificios salen los pseudópodos) Ciliados

Figura 116Paramecium Tomada de Biodidachttp://http://personal.telefonica.terra.es/web/ayma/atlas_p.htm#Paramecium%20caudatum

Se desplazan y capturan el alimento por medio de cilios, filamentos cortos, vibrátiles y numerosos que rodean su cuerpo. Se caracterizan por ser los únicos organismos con dos núcleos uno para la reproducción y otro relacionado con la alimentación.

173

Ejemplos de este filo son: el Paramecio, la Vorticela, el Balantidium coli parásito del intestino del hombre causante de inflamación del intestino. Flagelados Para moverse utilizan unos filamentos largos y poco numerosos, llamados flagelos.Muchos son de vida libre y otros son parásitos, como el Tripanosoma, que produce la enfermedad del sueño.El tripanosoma es transportado por la saliva de la mosca tsé-tsé, que contagia al picar a otros seres vivos.

Figura 117 Tripanosomas en sangre

Tomada de Biodidac. http://www.irabia.org/web/ciencias/microbiologia/microbios/protozoo.htm Esporozoos

Figura 118 Plasmodio falciparum Tomada de: http://www.cdc.gov/malaria/spotlights/index_100504.htm

Carecen de órganos de locomoción son parásitos de células del hombre y de los animales .Se reproducen por división múltiple, formando numerosas esporas. Un representante es el Plasmodio, que produce la malaria, también llamada paludismo. El Plasmodium hembra infecta los glóbulos rojos causándoles su

174

ruptura. El vector que transmite la infección es el mosquito Anopheles que al picar a la persona le inyecta con su saliva el esporozoito. Importancia Biológica Los protozoos tienen importancia en las cadenas alimentarias como componentes del plancton Para saber más http://www.alaquairum.com/generalidades_protozoos.htm

Algas Principales características Son organismos autótrofos, todas poseen clorofila y algunas poseen otros pigmentos que pueden enmascarar la clorofila, son eucarióticas con pared celular, habitan en medio acuático, ambientes húmedos y pertenecen al reino de los Protistos. La mayoría de algas son unicelulares como las algas doradas o diatomeas, otras como las algas verdes y las rojas son multicelulares. Pueden vivir solitarias o en colonias. Ejemplo de algas verdes tenemos: el volvox, y la spirogyra. Su reproducción puede ser sexual y asexual: por fisión binaria o por producción esporas.

Figura 119 Alga Closterium Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

175

Figura 120 Alga Spirogyra Tomada de http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

Importancia biológica Representan un importante eslabón en la cadena alimentaria, formando parte del plancton (productores primarios). Son productoras de oxígeno Útiles en la elaboración de fármacos Las algas rojas son importantes en la formación de arrecifes de coral pues viven en simbiosis con los corales brindándoles carbonato de calcio y suministrándoles el color rojo brillante Algunos grupos de algas rojas se utilizan en la producción de Agar que es un medio de cultivo microbiológico. Las algas marinas son una importante fuente alimenticia. Hongos Características Los hongos son organismos unicelulares como las levaduras o pluricelulares como los hongos filamentosos. Los hongos presentan pared celular compuesta de quitina que es un polisacárido estructural que también se encuentra en el exoesqueleto de los artrópodos. Habitan en ambientes húmedos y oscuros por ejemplo sobre el suelo, las frutas el pan, el queso, las plantas.

176

Figura 121hongo del tomate Tomada de: http://www.joseacortes.com/galeriaimag/microorganismos/index.htm#hongos

Su tipo de nutrición es la heterótrofa, algunos son parásitos de organismos vivos como plantas, animales y el hombre, a quienes pueden ocasionar enfermedades, otros son saprófitos es decir se alimentan de materia orgánica en descomposición y hay hongos que crecen en simbiosis con las raíces de algunas plantas formando las micorrizas.Los hongos pluricelulares forman una serie de filamentos denominados hifas; el conjunto de hifas forman un micelio. Existen tres tipos de hongos: Las setas formadas por un pie y una sombrilla como el champiñón, las levaduras que son unicelulares y los mohos que presentan un aspecto de pelusa. Reproducción Las levaduras se reproducen por gemación consistente en que a la célula madre le sale un botón o gema que poco a poco se va desprendiendo de ella dando origen a una levadura hija idéntica a la madre. Los hongos filamentosos como el moho del pan, se reproducen de forma asexual, por esporas que al caer en el sustrato adecuado dan origen a nuevas hifas, en este tipo de reproducción el núcleo de la célula madre se divide en varios núcleos, cada uno toma una parte del citoplasma de la célula madre que luego se rodea de una membrana celular, la célula madre se rompe y se liberan varias células hijas. Otro tipo de reproducción asexual presente en los hongos es por fragmentación del micelio. La reproducción sexual es otra forma de reproducción de los hongos. Enfermedades causadas por hongos En los animales los hongos pueden producir enfermedades graves en la piel y en los órganos, por ejemplo:

177

El hongo Aspergillus afecta los pulmones y el sistema nervioso Las Micotoxinas son toxinas producidas por hongos tóxicos genéticos (Aspergillus, Penicillium, Fusarium) que se desarrollan en los productos agrícolas. Candida albicans afecta a las aves causándoles la muerte, en el hombre afecta las mucosas de la boca, garganta y tracto genitourinario. Muchos hongos causan enfermedades en la animales.Algunas setas causan envenenamiento.

piel

del

hombre

y

los

Los hongos que contaminan los alimentos producen sustancias tóxicas que al ser consumidas por el hombre o los animales les causan enfermedades letales como la micotoxicosis. Las aflatoxinas producidas por ciertos hongos contaminantes de cereales y concentrados también causan enfermedades e inclusive la muerte. Muchos hongos causan enfermedades en la piel, uñas y cuero cabelludo, por ejemplo la tiña.Muchas enfermedades de las plantas son debidas a la presencia de hongos. Por ejemplo la roya.

Importancia biológica Los hongos no solamente causan enfermedades, sino que también son utilizados en procesos industriales por ejemplo: Del hongo Penicillium notatum se obtiene el antibiótico penicilina Las levaduras se utilizan para la producción de cerveza Algunos hongos son utilizados en la elaboración de queso Roquefort y en la maduración del queso Camembert Las enzimas de algunos hongos producen fermentación alcohólica en los jugos de frutas proceso que se utiliza por ejemplo, para la elaboración de vino a partir de jugo de uva. Algunos son comestibles como el champiñón. Para saber más http://www.ual.es/GruposInv/myco-ual/clados.htm

178

179

Capitulo 4 Sistemática Introducción Debido a la gran diversidad de organismos en la naturaleza, los biólogos vieron la necesidad de utilizar un sistema de clasificación que permitiera agruparlos por sus características macroscópicas y microscópicas comunes, por su similitud en las etapas de desarrollo, por su parecido en la composición bioquímica, por su semejanza genética, con el fin de estudiarlos y así entender su origen, su evolución y las relaciones de parentesco entre sí. La taxonomía o, mejor dicho, los taxónomos, son los que se encargan de poner algo de orden a la inmensidad de la vida, intentando averiguar las relaciones filogenéticas existentes entre los distintos organismos. Para conseguir esto se han ido creando una serie de categorías artificiales que no son sino simples entelequias mentales producto, una vez más de nuestra mente compartimentalizadora, que busca esquemas lógicos que le permitan reducir la enorme diversidad existente a algo más sencillo y, por ello, medianamente comprensible. Podemos hacer una excepción a esto con la especie, que parece ser algo "natural", aunque sobre ello volveremos más adelante

180

Lección 17 Taxonomía La taxonomía es una división de la sistemática relacionada con la clasificación de los organismos según especializaciones. La Taxonomía proporciona los métodos, principios y reglas para la clasificación de los organismos vivos en taxones (grupos) a los que se les asigna un nombre y se los ubica dentro de categorías jerarquizadas. Las categorías consisten en grupos o niveles dentro de grupos en la que el grupo mayor abarca al menor. El agrupamiento de los organismos se basa en las semejanzas y diferencias tanto naturales (estructurales) como filogenéticas (relaciones de parentesco o afinidades con otros organismos ya desaparecidos). La taxonomía proporciona información directa e inferida sobre la estructura del cuerpo y la historia evolutiva de los organismos respectivamente.

181

Las semejanzas estructurales de los organismos vivientes se conocen bien en su mayor parte. Pero los estudios de la historia evolutiva, para muchos de categoría superior inclusive es incompleta. Frente a esta dificultad taxonómica, se ha intentado establecer sistemas de clasificación alternativa, que muestren el grado actual de evolución. Sistemas de clasificación De Robert Whittaker (1969)

Figura 122 Sistemas de clasificación de los seres vivos por Robert Whittakertomada de http://www.euita.upv.es/varios/biologia/images/Figura s_tema18/tema18_figura 8.jpg

El esquema filogenético presentado por Whittaker clasifica a los organismos vivientes en 5 reinos: Mónera, Protista, Hongos, Plantas y Animal. Esta clasificación está basada en el tipo de organización celular: procariote y eucariote; en la forma de nutrición: autótrofa por fotosíntesis o heterótrofa por absorción; en la morfología y bioquímica de los organismos sin incluir análisis moleculares sin dar implicaciones evolutivas. Algunas características de estos reinos Mónera microorganismos procarióticos (sin membrana nuclear), unicelulares, con tipo de nutrición por absorción o fotosintética, con reproducción asexual, rara vez

182

sexual, con locomoción por medio de flagelos o inmóviles. Se encuentran en todos los medios. Pertenecen a este reino las bacterias y las cianobacterias. Protistas microorganismos unicelulares, eucarióticos (con membrana nuclear, mitocondrias y otros organelos) su tipo de nutrición es la absorción, la ingestión, y la fotosíntesis, pueden ser inmóviles o desplazarse por medio de flagelos, su reproducción se puede realizar por procesos asexuales o por procesos sexuales. Pertenecen a este reino los protozoos y las algas. Fungi (hongos) organismos eucarióticos, en su mayoría multicelulares, multinucleares, su nutrición es por absorción, son inmóviles, su reproducción incluye ciclos asexuales y sexuales. Son representantes de este reino los hongos o mohos pluricelulares y las levaduras unicelulares. Plantae (plantas) organismos eucarióticos, multicelulares, la mayoría fotosintéticos aunque algunos son simultáneamente absortivos, inmóviles con reproducción sexual y asexual. Pertenecen a este reino, según Witthaker, los vegetales superiores, las algas rojas, las algas pardas (Nota: actualmente se debe tener en cuenta que las algas se clasifican más estrictamente como protistas), los helechos, los musgos. Algunas plantas, al evolucionar, aunque mantienen su condición fotosintética han adquirido una condición semiparásita, por la cual parte de su nutrición la consiguen por absorción a partir de otras plantas que perforan para absorberles ciertos nutrientes. Un ejemplo de este caso es el muérdago. Algunas plantas insectívoras, además de su condición fotosintética, también adquieren condición complementariamente absortiva al tomar nutrientes absorbidos de los insectos que cazan. Animalia (animal) Organismos eucarióticos, multicelulares, su nutrición es la ingestión y la digestión, reproducción predominantemente sexual, pertenecen a este reino los animales invertebrados (artrópodos, no artrópodos) y vertebrados (mamíferos, aves, reptiles, anfibios y peces). De Lynn Margulis (1985)A partir de la clasificación de Whittaker surge la de Lynn Margulis-Schwartz basada en análisis moleculares. Lynn Margulis desarrolla la Teoría endosimbiótica, su sistema de clasificación presenta implicaciones evolutivas, es más filogenético y tiene la ventaja de hacer grupos más homogéneos. Cambia el reino protistas por de PROTOCTISTAS, en el que incluye a protozoos, todas las algas (excepto cianofíceas) y a los hongos inferiores. Su sistema de clasificación comprende 5 reinos y 2 subreinos asi:

183

Reino Prokaryotae o Monera Subreino:Archaebacteria Subreino: Eubacteria Reino Protoctista Reino Plantae Reino Fungi Reino Animalia De Carl Woese (1990)

Figura 123 Sistema de clasificación de los seres vivos De Carl Woese por tomada de http://www.euita.upv.es/varios/biologia/images/Figura s_tema18/tema18_figura 8.jpg

Los trabajos de Carl Woese secuenciando ácidos nucleicos descubrió que dentro del grupo de los procariotas se habían incluidos organismos que, a nivel molecular, eran bastante divergentes, en 1990 planteón la necesidad de separar todos los seres vivos en tres grandes dominios (categoría por encima del reino): Eubacteria (o bacteria verdadera), Arqueobacteria o Archaea (que significa antiguo) y Eucarya. Los dos últimos dominios (Archaea y Eucarya) están más próximos filogenéticamente (siendo grupos hermanos, según la terminología cladista). Las arqueobacterias se diferencian de las eubacterias por la composición de sus paredes celulares, su metabolismo y habitat.

184

http://www.danival.org/100%20biolomar/4000notasbio/clas/clas_3_dominios.html Los Archaea son células Procariotas. Al contrario de Bacteria y Eucarya, tienen membranas compuestas de cadenas de carbono ramificadas unidas al glicerol por uniones de éter y tienen una pared celular que no contiene peptidoglicano. Mientras que no son sensibles a algunos antibióticos que afectan a las Bacterias, son sensibles a algunos antibióticos que afectan a los Eucarya. Los Archae tienen rRNA y regiones del tRNA claramente diferentes de Bacterias y Eucarya. Viven a menudo en ambientes extremos e incluyen a los metanógenos, halófilos extremos, y termoacidófilos. Bacteria (Eubacteria) Las Bacterias son células Prokariotas. Como los Eukarya, tienen membranas compuestas de cadenas de carbono rectas unidas al glicerol por uniones éster. Tienen una pared celular conteniendo peptidoglicano, son sensibles a los antibióticos antibacterianos tradicionales, y tienen rRNA y regiones del tRNA claramente diferentes de Archaea y Eukarya. Incluyen a mycoplasmas, cyanobacteria, bacterias Gram-positivas, y bacterias Gram-negativas. Eukarya (Eukaryota) Los Eukarya (escrito también Eucaria) son Eukariotas. Como las Bacterias, tienen membranas compuestas de cadenas de carbono rectas unidas al glicerol por uniones éster. Si tienen pared celular, no contiene ningún peptidoglicano. No son sensibles a los antibióticos antibacterianos tradicionales y tienen rRNA y regiones del tRNA claramente diferente de Bacterias y Archaea. Incluyen a protistas, hongos, plantas, y animales. Los reinos "clásicos" no son más que unas pequeñas ramitas del gran árbol de la vida, aunque son las ramitas que mejor conocemos. Por ejemplo, el reino Animalia, es una de las ramas del dominio Eucarya. Categorías taxonómicas supraespecíficas Las clasificaciones de los organismos son jerárquicas. Linneo trató de clasificar las especies conocidas en su tiempo (1753) para esto agrupo a los organismos en categorías. La clasificación Linneana se basó en la premisa que la especie era la menor unidad de clasificación y que cada categoría o taxón se encuentra comprendida en una categoría superior.

185

Las categorías taxonómicas básicas o taxones son 8, cuando se requiere mayor precisión se recurre a otras categorías secundarias como: subespecie, superfamilia, infraorden Los taxones anteriormente mencionados y ordenados del más amplio al menos amplio (en negrita las principales), son: Reino Filo Superclase Clase Subclase Superorden Orden Suborden Infraorden Superfamilia Familia Subfamilia Tribu Subtribu Género Subgénero Especie Subespecie Como se puede comprobar en este esquema de categorías enlazadas, un género sería un conjunto de especies relacionadas por criterios de parentesco; una familia sería un conjunto de géneros relacionados, un orden un conjunto de familias, una clase un conjunto de órdenes y un filo un conjunto de clases, todo esto guiado por nuestros conocimientos en evolución, ya que se pretende que la clasificación se asemeje lo más posible a la filogenia de los distintos organismos. La especie es la única unidad que existe en la naturaleza, las demás categorías son creadas artificialmente.La unidad básica para clasificar los seres vivos es la especie.

186

Figura Categorías supraespecíficas Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

Figura 124Categorías supraespecíficas Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

187

Clave taxonómica Para facilitar la determinación y ubicación taxonómica de los seres vivos los taxónomos utilizan una serie de claves, una de las más utilizadas es la dicotómica en la cual las características tenidas en cuenta tienen 2 opciones de selección. Por ejemplo: a) ausencia de pelo b) presencia de pelo; a) esqueleto óseo b) esqueleto cartilaginoso; a) poseen exoesqueleto, b) Cuerpo blando El concepto de especie A uno le podría parecer que, ya que todo biólogo, sea cual sea su campo de estudio, debe trabajar de algún modo con especies, se debería tener claro en todo momento que cosa es una especie. Sin embargo esto dista mucho de ser así. Se han ido dando, a lo largo de la historia, numerosos conceptos de especie, todos ellos válidos en el momento en el que fueron enunciados, pero que han ido quedando desfasados por paso del tiempo o están actualmente en discusión. A continuación se enumeran una serie de definiciones para dicho concepto (las tres últimas tomadas en parte de Casares, (1998), que reflejan el pensamiento que en cada momento se tenía, no sólo sobre lo que era una especie, sino también sobre la vida en general. El concepto morfológico de especie fue el que se usó hasta que la evolución y se convirtió en el paradigma científico en el que se basa la Biología actual. Este concepto postula que las especies se pueden definir con base en unos caracteres taxonómicos tipo, que representan la esencia de cada especie; por tanto, basta con tomar un ser vivo, describirlo tal y como se nos presenta, y todos los que concuerden con esa descripción serán de su misma especie, siendo de distintas especies aquellos que difieran. En este contexto, la variación intraespecífica no es más que un distractor antes de llegar a la esencia de la especie. Por desgracia, este criterio, que debería haber sido ya totalmente relegado a la Historia de la Ciencia, sigue vigente en los trabajos de algunos taxónomos (algo que ellos negarían rotundamente), que ante la mínima diferencia con el ejemplar tipo, describen nuevas subespecies y/o especies, con lo cual sólo consiguen enredar las relaciones interespecíficas y dificultar el estudio de los distintos grupos. El concepto nominal de especie, que tuvo en Darwin a uno de sus máximos defensores, postula que no existen las especies, solo los individuos concretos, y que la especie no es más que una abstracción hecha "para entendernos", contingente al momento actual y carente de significado en el tiempo.

188

Sin embargo, a la hora de enfrentarse a la práctica cotidiana, los nominalistas describen especies no sólo en el momento actual (algo que concordaría con su concepto de especie) sino también en el registro fósil, algo no coherente con ese concepto. Actualmente este concepto parece descartado. El concepto biológico de especie; enunciado por Mayr en 1963, que la define como el "conjunto de poblaciones que real y potencialmente pueden reproducirse entre sí, pero que están aisladas de otros grupos similares", está basado en el "aislamiento" entre especies, algo muy aceptado en teoría pero con numerosísimas excepciones en la práctica. Presenta además problemas con especies de distribución espacial o temporal amplia, y con organismos de reproducción asexual. El concepto de reconocimiento de especie, enunciado por Paterson en 1985, que la define como el "conjunto de individuos y poblaciones que comparten un mismo sistema de fertilización", es decir, de reconocimiento entre individuos de distinto sexo y de compatibilidad entre los genes aportados por cada uno. Bastante similar al anterior, presenta los mismos inconvenientes. El concepto evolutivo de especie, que la define como el conjunto de poblaciones que comparten un destino evolutivo común a lo largo del tiempo. Consigue soslayar los problemas de las definiciones anteriores, pero presenta uno nuevo: ¿qué se entiende por destino evolutivo común a la hora de considerar organismos vivos? Convención práctica Para efectos prácticos se puede adoptar convencionalmente la siguiente definición tomada de Nelson G. (2000) Una especie es una población con aislamiento reproductivo, que se reconoce por caracteres morfológicos particulares y que ocupa un área geoFigura definida. Nomenclatura Como de una forma más o menos implícita insinuábamos antes, cualquier tipo de estudio en Biología, debe tener una cierta base taxonómica. Si no sabemos el nombre de los animales o de las plantas con que trabajamos, nos resultará bastante difícil sacar algo en claro de nuestros estudios. Una vez que agrupamos a los organismos por especies, se nos presenta el problema de qué nombre ponerle a cada especie, para poder hacer referencia a ella más adelante. Al principio se intentó dar nombres vulgares a todas las especies, o se las intentó describir abreviadamente mediante una frase que resaltara sus características más conspicuas. Tras varios intentos de varios autores, se acabó aceptando el sistema binomial de Linneo, establecido en su obra Systema Naturae, cuya décima edición (1758) sirve como punto de partida.

189

Este sistema asigna a cada especie un nombre compuesto de dos palabras. La primera palabra corresponde al nombre científico del género y se escribe la primera letra con mayúscula y en cursiva , mientras que la segunda palabra es el epíteto específico y corresponde a la especie, la cual se escribe también en minúsculas y en cursiva, por ejemplo, el nombre científico para el hombre es: Homo sapiens. El nombre científico esta escrito en latín para permitir la comunicación universal.Si se escribe a mano en cursiva, entonces el nombre científico se subraya.En el caso de que todo el texto circundante esté escrito en cursiva, el nombre científico se escribe normal. Generalmente la comunidad académica dedicada al estudio de determinado reino de especies biológicas utilizan algunos protocolos particulares para el proceso de nomenclatura.Por ejemplo, en el caso de que haya subespecie, ésta se escribe a continuación de la especie, también en cursiva y sin ninguna palabra intercalada, hecho este que diferencia el Código Internacional de Nomenclatura Zoológica (CINZ) del Código Internacional de Nomenclatura Botánica, en el que aparece la abreviatura subsp. intercalada. Según el CINZ, no tienen validez los táxones infrasubespecíficos. Por ejemplo, el nombre científico del pez Aphyosemion bivittatum hollyi, el primer nombre corresponde al género, el segundo a la especie y el tercero a la subespecie Tras el nombre del taxón específico se incluye el nombre del autor y el año en que fue descrito por primera vez, Por ejemplo, Poecilia reticulata Peters, 1859. Si la planta o animal ha cambiado de nombre se pone entre paréntesis el nombre anterior en letra no cursiva, pero el nombre del autor que lo describió sigue vigente. En el ejemplo anterior, el pez fue denominado por Peters. Lebistes (género) entonces se escribe Poecilia reticulata (Lebistes), Peters, 1859. Los nombres científicos revelan datos interesantes, no sólo sobre la especie en cuestión, sino también sobre el científico que la describió. Así abundan los nombres científicos referidos a personajes de la mitología grecorromana, sobre todo en Lepidópteros. Por ejemplo, dentro de la familia de los Papiliónidos, nos encontramos con Iphiclides podalirius y Papilio machaon, dos bellas mariposas cuya similitud nos recuerda Linneo al ponerles los nombres de dos médicos homéricos. El estudio de estos nombres científicos nos puede proporcionar, como mínimo, unos ratos muy interesantes.

190

En el mundo de los insectos las clasificaciones de especies nuevas son difíciles y, muchas veces extenuantes, de lo que dan fe Stroudia difficilis, Paravespa gestroi problemática y Bombus perplexus. Estarían también los nombres puestos por entomólogos sin ninguna imaginación como Coeleumenes secundus, Leptochilus tertius, Eudynerus nonus (sinonimizado con E. octavus, para desesperación de los matemáticos). Naturalmente en la Entomología también existe el peloteo, la egolatría y el autobombo, del que podría dar fe el lepidóptero Cartwrightia carwrighti cuyo autor, un tal Carwright, justificó la semejanza con su nombre alegando que había dedicado el nombre genérico a su padre y el específico a su hermano. Pero sin duda alguna el caso más alarmante sería el protagonizado por Embrick Strand; en una revista dirigida por él mismo, y dentro de unos tomos dedicados al editor de la revista, que casualmente también era él, apareció un artículo firmado por un tal Jan Obenberger en el que se describían 92 nuevas especies de coleópteros, de las cuales 50 llevaban en alguna parte de su nombre científico un apelativo a Strand, ya usando su nombre, su apellido, ambos o una derivación de ellos. La construcción de árboles filogenéticos Uno de los objetivos de la sistemática es la filogenia o sea la clasificación de las especies teniendo en cuenta sus relaciones de parentesco.La construcción de árboles filogenéticos, representa hipótesis evolutivas y trata de definir grupos monofiléticos (ancestro y descendientes). Para construirlos, se deben tener datos que provienen de las características usadas en la clasificación. Métodos de clasificaciónExisten muchos métodos de clasificación, según la manera en que evalúan ciertos caracteres, entre ellos a. El tradicional o evolucionista, b. La fenética o taxonomía numérica y c. La cladística o filogenética a. El tradicional o evolucionista Los criterios usados en la sistemática tradicional enfatizan en tanto el antecesor común (monofilésis), como en el peso de la divergencia entre grupos Los organismos se agrupan en especies teniendo en cuenta:

191 • La utilización del concepto biológico de especie, basado en propiedades biológicas (la comunidad reproductiva) • La utilización de caracteres morfológicos y no morfológicos y la necesidad de valorar adecuadamente (con métodos estadísticos si es necesario) la variabilidad. • La necesidad de ponderar similitud morfológica y parentesco filogenético en caso de conflicto Sin embargo si tomamos como ejemplo la agrupación lagartos, cocodrilos, y aves como se observa en la Figura

Figura 125Determinación de grupo monofilético por ancestro común Tomada de:http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogenetica/tema_1.ht m

Por su parecido entre sí (caracteres morfológicos) los lagartos y cocodrilos se agrupan en un taxón Reptiles según la clasificación tradicional. Pero si tenemos como criterio el parentesco filogenético, es decir, la proximidad de los ancestrales comunes, aves y cocodrilos son ramas derivadas de un linaje común ( línea naranja ) y por lo tanto, comparten un mayor grado de parentesco y se agrupan en un taxón que se ha denominado "Arcosaurios", desde el punto de vista de la clasificación cladista. En conclusión al tomar en cuenta ambos criterios: similitud de caracteres morfológicos y parentesco filogenético, como lo hace la clasificación tradicional o evolucionista, puede presentarse conflicto en la agrupación y se requiere tomar el sistema de clasificación más apropiado para ponderar el peso de los caracteres.

192

b. Fenética o taxonomía numérica. Agrupa a los organismos estrictamente por el número de caracteres que tienen en común (similitud morfológica) y los cuantifica en índices de similitud o de distancia. Dichos índices reflejan el parecido global entre los taxones. Estos procedimientos se basan en el uso de matrices en las que se incluyen valores numéricos de determinados atributos de las unidades a agrupar, unidades llamadas OTUs (de operative taxonomical unity) que pueden ser individuos, muestras de poblaciones o especies, etc. Los atributos pueden ser medidas, proporciones, recuentos o caracteres semicuantitativos (por ejemplo: 0=ausencia, 1=presencia). La idea es que cuanto más similares sean dos OTUs, menor será la diferencia global entre los valores de sus atributos. De esta forma se pueden definir índices de distancia fenética, como por ejemplo la media cuadrática de las diferencias entre cada par de atributos. En el caso de identidad total entre dos OTUs dicho índice valdría 0, y será mayor cuanto más disimilares sean los OTUs. c. Cladística y Cladogramas

193

194

La cladística es un tipo de sistemática desarrollada por Willi Hennig, tratando de conseguir un método mas objetivo de clasificar organismos. En sistemática filogenética o cladistica se agrupan los organismos en los taxones exclusivamente en función de su grado de parentesco filogenético, es decir, en función del orden relativo de sus ancestrales comunes. Dado que los taxones están compuestos por organismos emparentados (descendientes por tanto de un ancestral común a todos ellos) todos los taxones, todas las unidades de clasificación, deberán ser estrictamente monofiléticos. Una agrupación no monofilética, no formada por todos y cada uno de los descendientes de un ancestral común, no puede ser constituida como taxón

Figura 126 Cladograma mostrando relaciones evolutivas Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

En la Figura anterior, el criterio o carácter huevo con amnios se usa para unir al grupo de aves, reptiles y mamíferos que por compartir este carácter primitivo se deduce que tienen un antecesor común. La característica presencia de plumas y el pelo para separar aves y reptiles de mamíferos en el caso de clasificación tradicional, no es un factor en las hipótesis cladísticas, o cladograma, dado que son caracteres únicos en un taxón del grupo. Una de las aplicaciones más interesantes de la cladística es la cuestión de los pandas. En un principio se pensó que el oso menor era un oso, pero por sus caracteres cercanos a los mapaches hizo que se los colocara cercanos a ellos. El panda menor vive en la misma región de China que el panda gigante pero tiene grandes similaridades con los mapaches, mientras que los estudios de hibridización de ADN sugieren que el panda gigante esta en el clado de los osos y el panda menor en el clado de los mapaches.

195

Ambos comparten un antecesor común, como lo indica los caracteres derivados o evolutivos que comparten, además de los otros caracteres derivados de la evolución convergente (adaptaciones a su única fuente de energía: el bambú).

Figura 127Divergencia de antecesor común Tomado de: http://fai.unne.edu.ar/biologia/evolucion/clasif.htm

La Figura muestra esta divergencia del antecesor común, e intenta además mostrar el tiempo al cual ocurrió esa divergencia. Un interesante y ameno relato respecto al tema de sí las aves se originan o no de los dinosaurios se encuentra en Investigación y Ciencia, El origen de las aves y su vuelo, K. Padian y L.M Chiappe, 1998. Profundización:Curso intercativo de sistemática http://www.ciencias.uma.es/departamentos/bioanimal/sfonline/sistematicafilogeneti ca/indice.htm

196

Actividades Verificación de estructuras conceptuales sobre los conceptos relacionados con las unidad 1 capitulo: Los microorganismos Unidad 1: Estructura, función y diversidad de los seres vivos. Capitulo 4: Los microorganismos Fase de reconocimiento Situación de salida/ Metas para competencia: El estudiante identifica las características de los seres vivos, su estructura, función y diversidad. Aspectos procedimentales Situación 2 Tiempo previsto de desarrollo: 3 minutos Carácter de la actividad: individual Sistema de interactividades: (Solo es estudio personal)

Situaciones didácticas Actividades de entrada:

Producto:

La actividad consiste en completar los espacios en blanco con la palabra que usted crea que complementa mejor la oración. Tiene máximo tres minutos para pensar y responder cada uno. Por favor no recurra a libros o diccionarios porque sería inútil el objeto de la actividad.

En su PDP guarde el texto con los espacios en blanco diligenciados

(Comprobar 1. Existe una clasificación de los organismos respuesta vivos según la estructura de las células. En Recursos tecnológicos: el grupo de los _________________ están los microorganismos en cuyas células el Aula virtual. material genético (ADN) no se encuentra organizado en un núcleo, es decir, no se Formato de encuentra rodeado por una membrana. objetivación/ productos: Texto 2. Dentro del grupo de la pregunta anterior completo se encuentran las _____________, microorganismos unicelulares que Sistema de evaluación: estructuralmente son rodeados por formativa: membrana y pared celular. autoevaluación, PDP 3. Continuando con la clasificación de Seguimiento: organismos por la estructura de sus células, autorregulación (no los organismos que pertenecen al grupo de necesita enviar al tutor ni los _______________ son aquellos que se a la dirección nacional) caracterizan por poseer células especializadas como las de los animales y las plantas. 4. Los _______________ son microorganismos importantes en la producción de antibióticos, son filamentosos

197

y se encuentran dentro del grupo de los ___________________ por la estructura de sus células. 5. Para preparar medios de cultivo de microorganismos se usa el ____________ que es una sustancia de consistencia gelatinosa que se obtiene de algas marinas. 6. Los microorganismos __________________ son aquellos que son capaces de producir enfermedades. 7. La ________________ se conoce como el manejo, modificación genética y propagación de organismos vivos mediante el uso de tecnologías como el cultivo de tejidos y la ingeniería genética, que dan como resultado la obtención de organismos nuevos o mejorados. 8. Cuando las condiciones del medio se han hecho desfavorables para vida de organismos como las bacterias, éstos son capaces de producir unas estructuras llamadas ______________ que las protegen de altas temperaturas y ambientes con poca humedad. 9. Las _________________ son microorganismos unicelulares, pertenecen al reino de los __________________ y son las responsables de la fermentación alcohólica de la cerveza. Los ________________ son compuestos de núcleo-proteínas; no son considerados organismos vivos; son demasiado pequeños como para observarlos en microscopio óptico, se propagan sólo en el interior de células vivas y tienen capacidad de producir enfermedades

198 Fase de profundización:Elaboración de mapa conceptual, ensayo o cuadro sinóptico sobre temáticas de la unidad 1 para analizar relaciones entre conceptos Unidad 1: Estructura, función y diversidad de los seres vivos. FASE DE PROFUNDIZACIÓN Situación de salida/ Metas para competencia: El estudiante identifica, describe y analiza con propiedad las características de los seres vivos, su estructura, función y diversidad. Aspectos procedimentales Situación 7 Tiempo previsto de desarrollo: 6 h Carácter de la actividad: individual grupo colaborativo máximo de 3 personas Sistema de interactividades: Acompañamiento Tutorial en Grupo de curso asincrónica 1h Recurso tecnológico : aula virtual o materiales impresos

Situación didáctica Actividades de entrada: º Elabore un mapa conceptual socialícelo en pequeño grupo colaborativo a través del aula Virtual y luego incorpore ajustes basados en la realimentación resultante de la socialización. En su ejercicio deben aparecer los siguientes conceptos que se encuentran sin orden jerárquico y que usted debe reordenar y organizar jerárquicamente agregando las palabras enlace y los conectores:

funciones de la célula, sistemas de comunicación, sexual, relación, autótrofa, ADN lineal , asexual, nutrición, respiración, Formato de objetivación/ productos: reproducción, mitosis, exocitosis, digestión, movimiento, energía, Informe con mapa heterótrofa, fotosíntesis, conceptual mitocondrias, crecimiento, procariota, endocitosis, Sistema de evaluación: respuestas, transporte de Sumativa: membrana, pinocitosis, meiosis, Heteroevaluación. PDP absorción, eucariota, estructuras membranosas, citoesqueleto, Seguimiento: PDP por ribosoma, membrana nuclear, ADN parte del tutor y de cadena doble circular sistematización enviada al director nacional para Los resultados de la actividad se seguimiento y incorporarán en su PDP y se realimentación publicarán en el aula Virtual para socialización y realimentación con el tutor y demás compañeros.

Producto ° Mapa conceptual en PDP y enviado al tutor y socializado en el aula Virtual.

199 Actividad Fase transferencia:Actividad sobre procesos en consumo de hamburguesa para identificar aprendizajes y experiencias previas sobre las unidades 1,2 y3 Unidades 1,2 y 3: Estructura, función y diversidad de los seres vivos. Ecología y evolución Fase de transferencia Situación de salida/ Metas para competencias: El estudiante identifica las características de los seres vivos, su estructura, función y diversidad. Aspectos procedimentales Situación 14.

Situaciones didácticas Actividades de entrada:

Tiempo previsto de desarrollo: 10 horas

° Describa los fenómenos que ocurren en la siguiente situación:

Carácter de la actividad: individual 3h

° 8 horas después de consumir una hamburguesa, compuesta por pan, lechuga, tomate, queso y carne, qué procesos se han desarrollado en su organismo. Para su respuesta considere lo siguiente:

Sistema de interactividades: Tutoría individual y/o de grupo colaborativo de realimentación en el foro de discusión del aula virtual 1 h

1. Que órganos han intervenido? 2. Qué sistemas han interactuado? 3. Qué elementos ha asimilado su organismo? 4. Para qué sirven los alimentos Recurso tecnológico: asimilados? Aula virtual 5. En los componentes utilizados para preparar la hamburguesa qué tipo de Formato de microorganismos intervinieron objetivación/ previamente? productos: Respuestas 6. El cerebro ordena el comportamiento individuales a las preguntas de la actividad. del organismo, en coherencia con el tipo de nutrientes que recibe. ¿Qué efectos Retroalimentación a las puede causar una alimentación sin respuestas de los proteínas ni verduras ni frutas en el compañeros de equipo. Informe de equipo con los comportamiento humano? 7. Qué efectos ambientales puede acuerdos para cada respuesta publicado en el causar el consumo diario de millones de hamburguesas en el mundo? Aula Virtual Sistema de evaluación: Use el módulo de Biología y las fuentes Sumativa: heteroevaluación: informe documentales que considere necesarias. y participación en el foro Responda las preguntas en forma individual y colóquelas en el foro de de discusión. Coevaluación de cada uno discusión en el espacio de TRABAJO

Producto: ° Respuestas individuales a las preguntas planteadas. ° Coevaluación de los compañeros de equipo colaborativo. ° Informe del grupo colaborativo.

Puntaje de evaluación: Coevaluación 3 puntos Participación en el foro de discusión 7 puntos Informe del grupo colaborativo 10 puntos

200

de los compañeros del equipo colaborativo Seguimiento: del Portafolio de Desarrollo Personal por parte del tutor y sistematización enviada al director nacional para seguimiento y realimentación

INTELECTUAL. Retroalimente las respuestas de cada uno de sus compañeros. Use el mensaje en donde su compañero dio la respuesta a la pregunta, haciendo click en responder. Responda los mensajes de retroalimentación de sus compañeros. Use el mensaje en donde su compañero dio la retroalimentación, haciendo click en responder. Cada estudiante debe llegar a una conclusión final después de este proceso, que coloca en el foro de discusión en el espacio trabajo intelectual del equipo. El ejercicio de participación en el foro de discusión tiene un valor evaluativo de 10 puntos y es evaluado por el tutor. Realizado el ejercicio confronte las respuestas de todos los miembros del grupo colaborativo y elabore un informe dando las respuestas del equipo a cada pregunta. El informe debe llevar las siguientes especificaciones: Archivo de Word. Margenes de 3cm. Letra Arial 10 Interlineado de 1.5 Los estudiantes que no han realizado participación no pueden aparecer en el trabajo que consolida las respuestas del equipo. Se debe anexar como archivo de PDF, en el foro de discusión espacio ENTREGA DE PRODUCTO. Este producto lo evalúa el tutor y tiene un puntaje de 15 puntos. Es importante señalar que las

201

respuestas deben ser argumentadas en fuentes documentales consultadas, tanto las del informe como en las individuales. Una vez finalizada la actividad y enviado el producto cada miembro del grupo colaborativo evalúa a sus compañeros, en el foro de discusión espacio COEVALUACIÓN, esta evaluación tiene un valor de 5 puntos.

202

UNIDAD 2. GENÉTICA Y BIOTECNOLOGÍA Presenta las condiciones biológicas en que se basa la habilidad de almacenar y transmitir la información genética para explicar los mecanismos de herencia a nivel de biología molecular y las perspectivas de intervención humana en el mejoramiento genético de microorganismos, plantas y animales.

203

Capitulo 1 La información Genética Introduccion El término genética, introducido por Bateson en 1.906, se refiere al estudio de la transmisión de la información de caracteres entre padres e hijos a través de los cromosomas, mediante unidades hereditarias denominadas genes. Los caracteres son físicos, comportamentales y fisiológicos. Es así como todas las características que identifican a un organismo han sido heredadas, es decir, provienen de la información genética contenida en los gametos masculino, el espermatozoide, y femenino, el óvulo. Cromosomas En el proceso de división celular que se desarrolla en el núcleo de la célula, a partir de la cromatina se forman los cromosomas que son un par de estructuras longitudinales llamadas cromátidas unidas en un punto denominado centrómero. Diferenciación de especies por número de cromosomas Cada especie tiene un número característico de cromosomas en células somáticas (o sea las de todo el cuerpo excepto las células sexuales). Ejemplo: el hombre posee 46 cromosomas en las células somáticas, en el perro el número de cromosomas se eleva a 78, en el mosquito son 6, en el ciruelo 48, en el chimpancé 48, en el gato 38 y en la papa 48. Composición química básica de los cromosomas Incluye los siguientes elementos: Ácido desoxirribonucleico o ADN y una proteína la Histona que al unirse con el ADN forma las nucleoproteínas, que configura n casi hasta el 90% de los cromosomas. Las principales funciones que debe cumplir un cromosoma son la de replicarse (producir copias de si mismo), la de transmitirse de una célula a otra y de una generación a la siguiente y la de expresar la información que contiene

204

Figura 128Estructura del ADN Tomada de: http://www.ac-rennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.htm

Funciones del ADN  Almacenamiento codificado de la información genética que determina las características futuras de la célula y de los organismos que se desarrollen a partir de dicha información.  Replicación de si mismo o sea elaboración de una copia idéntica del ADN.  Síntesis de ARN  Transferencia mediante el ARN (ácido Ribonucleico) de la información genética a las moléculas que realizan la síntesis de proteínas por intermedio de los aminoácidos que son las unidades que forman las proteínas. Replicación del ADN Para poder transmitir la información genética codificada en el ADN este tiene que realizar una copia de sí mismo antes de comenzar el proceso de división celular es decir durante la interfase. La replicación se realiza en el núcleo de la célula y consiste en la separación de las dos cadenas de polinucleótidos del ADN (imaginese la apertura de una cremallera) y cada una se convierte en una matriz o plantilla para el montaje de una nueva cadena idéntica de ADN a la que se había separado.

205

Figura 129replicación del ADN Tomada de: http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/adn.htm

En este proceso los nucleótidos de las dos cadenas que formaban el ADN, una vez separadas, atraen nucleótidos complementarios previamente formados por la célula. Luego los nucleótidos complementarios se unen con los de la plantilla mediante puentes de hidrógeno para formar la estructura de una nueva molécula de ADN, semejando los travesaños de una escalera en espiral. La enzima ADN polimerasa une los nucleótidos complementarios que van encajando en la plantilla enlazando el grupo fosfato de uno con la molécula de azúcar del siguiente. De esta manera se construye la cadena lateral complementaria de ADN. El resultado final es una nueva molécula de ADN con su estructura de doble hélice. El significado genético de la replicación es el de conservar la información genética Animación: http://www.acrennes.fr/pedagogie/svt/cartelec/cartelec_lyc/premiere_s/vegetal/adn/ adn.htm#animation Transcripción o síntesis de ARN http://www.ucm.es/info/genetica/grupod/Transcripcion/Transcripcion.htm#Transcrip ción La transcripción consiste en la síntesis de ARN tomando como molde ADN y significa el paso de la información contenida en el ADN hacia el ARN. La transferencia de la información del ADN hacia el ARN se realiza siguiendo las reglas de complementaridad de las bases nitrogenadas y es semejante al proceso de transcripción de textos, motivo por el que ha recibido este nombre. El ARN producto de la transcripción recibe el nombre de transcrito.

206

En las bacterias la transcripción y la traducción tienen lugar en el citoplasma bacteriano y al mismo tiempo, son simultáneas. Sin embargo, en eucariontes la transcripción tiene lugar en el núcleo y la traducción en el citoplasma. La ARN polimerasa o enzima encargada de llevar a cabo la transcripción toma como molde el ADN para sintetizar ARN y sigue las reglas de complementaridad, la A del ADN empareja con U del ARN, la G con C, la C con G y la T con A. Existen experimentos que demuestran que la proporción (A+U)/G+C) del ARN es similar a la proporción (A+T)/(G+C) del ADN. A (de ADN) se complementa con U (de ARN) T (de ADN) se complementa con A (de ARN) G (de ADN) se complementa con C (de ARN) C (de ADN) se complementa con G (de ARN) Las ARN polimerasas sintetizan ARN siempre en la dirección 5'P a 3'OH, decir el ARN producto de la transcripción crece solamente en esta dirección. 2. Una secuencia del ADN, llamada promotor, le ordena a la célula comenzar a construir ARN mensajero, a partir del gen que le sigue.

Se transcribe para cada gen una de las dos hélices de ADN, (Asimetría de la transcripción) la hélice que se toma como molde para producir el ADN se la denomina hélice codificadora o hélice con sentido y la otra hélice de ADN, la que no se transcribe, se la denomina hélice estabilizadora o hélice sin sentido.

3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el núcleo.

207

4. El ARNm terminado puede ahora servir de molde para la correspondiente proteína. Sintesis de proteína Genotipo La información genética codificada que posee un organismo con relación a un rasgo particular para transmitirla a la siguiente generación, se conoce como genotipo. Fenotipo La apariencia o sea el aspecto externo de los individuos resultante de la herencia y su expresión durante el desarrollo en condiciones ambientales determinadas, se denomina fenotipo. Por ejemplo el color de la piel, del cabello, de los ojos, la estatura, la forma del cabello.

Genes Los genes son pequeños segmentos de largas cadenas de ADN que determinan la herencia de una característica determinada, o de un grupo de ellas.Los genes se encuentran localizados en los cromosomas en donde se disponen en línea a lo largo de ellos. Cada gen ocupa en el cromosoma una posición, o locus. El conjunto de genes se denomina genoma.

Figura 130 Estrutura del gen

208

Alelos Cada célula somática posee dos cromosomas homólogos, esto quiere decir que para cada carácter o rasgo se cuenta con un par de genes que pueden tener la misma o diferente información.De esta manera cada organismo contiene un gen de origen paterno y otro de origen materno. A este par de genes que determinan la expresión de una característica o carácter particular se les llama alelos. Cuando ambos alelos son iguales se aplica el término homocigoto a los individuos que los poseen. En cambio, si los alelos son diferentes, el organismo es heterocigoto o híbrido. Cuando en un individuo heterocigoto sólo uno de los alelos se expresa se le llama dominante y al otro que se mantiene oculto, se le conoce como recesivo. El alelo dominante para un carácter determinado se representa con una letra mayúscula y su alelo recesivo para el mismo carácter, se representa con la misma letra pero minúscula. Ejemplo: Para el carácter estatura alto o bajo el alelo dominante alto se representa con la letra mayúscula A y el alelo recesivo bajo se representa con la letra a minúscula Lección23 Leyes de Mendel, Aplicación de las leyes de Mendel, ejemplos de cruces Leyes de Mendel Después de una serie de experimentos con arvejas verdes y amarillas, observando como se transmitían las características de los padres en varias generaciones, el botánico Gregor Mendel planteó las leyes básicas de la transmisión de la herencia. Durante sus observaciones Mendel encontró que las características o rasgos almacenados de manera codificada en los genes podían corresponder a características puras homocigotas o características híbridas heterocigotas, en este último caso se trata de un par de características alternativas de las cuales una es dominante (o sea que es la que se manifiesta externamente en el organismo), y la otra es

209 recesiva, o sea que no se manifiesta externamente, pero permanece en la dotación genética y puede hacerse visible en las siguientes generaciones. Con base en lo anterior Mendel formuló las siguientes leyes: Ver video sobre las leyes de mendel aquí clic Primera ley de Mendel - Ley de la UniformidadSi se cruzan dos líneas puras (homocigotas) para un determinado carácter, los descendientes de la primera generación son todos iguales entre sí (igual fenotipo e igual genotipo) e iguales (en fenotipo) a uno de los progenitores. Como cada uno de los progenitores es homocigoto, solo le puede pasar a la descendencia el único alelo o variante del gen que porta. Segunda ley - Ley de la SegregaciónLos caracteres recesivos, al cruzar dos razas puras, quedan ocultos en la primera generación (F1), reaparecen en la segunda (F2) en proporción de 1:3 uno a tres respecto a los caracteres dominantes. Los individuos de la segunda generación que resultan de los híbridos de la primera generación son diferentes fenotipicamente unos de otros; esta variación se explica por la segregación de los alelos responsables de estos caracteres, que en un primer momento se encuentran juntos en el híbrido y que luego se separan entre los distintos gametos Ley de la DominanciaCuando se cruzan individuos que difieren sólo en un carácter por ejemplo color de la semilla (dominante y recesivo para este determinado carácter), la primera generación F1 será semejante al progenitor que tiene el carácter dominante. En este caso se habla de cruces monohíbridos Ley de la transmisión independiente o de la independencia de caracteres Establece que los caracteres son independientes y se combinan al azar. En la transmisión de dos o más caracteres, cada par de alelos que controla un carácter se transmite de manera independiente de cualquier otro par de alelos que controlen otro carácter en la segunda generación, combinándose de todos los modos posibles.

210 Cuando se cruzan progenitores con dos caracteres diferentes (ejemplo plantas puras es decir homocigotas con color de las semillas amarillo dominante AA y verde recesivo aa y forma de la semilla lisa dominante LL y rugosa recesiva ll), estos caracteres se trasmiten a la descendencia en forma independiente. En este caso se habla de cruces dihíbridos. Esto se observa mejor mediante un cuadro de Punnet que permite visualizar las posibles combinaciones para los cruces de caracteres. Ejemplo: En los experimentos de Mendel se encontraron: plantas puras de arveja con semillas de color amarillo dominante, o sea que sus alelos eran idénticos y se pueden denominar convencionalmente AA  plantas puras de arveja con semillas de color verde recesivas, las cuales denominaremos aa  plantas híbridas o heterocigotas con semillas de color amarillo, Aa  plantas puras de arveja con semillas lisas como característica dominante, LL  plantas puras de arveja con semillas rugosas como característica recesiva, ll  plantas híbridas o heterocigotas de arveja con semillas lisas, Ll 

Lección 24. Aplicación de las leyes de Mendel en la resolución de problemas sobre cruces monohibridos Para aplicar el cuadro de punnet analicemos primero el caso del cruce de plantas homocigotas o puras de arveja con semillas amarillas dominantes AA y plantas puras con semillas verdes recesivas aa (caso de cruce monohíbrido, o sea aplicado a un solo carácter en este caso color de la semilla) Se elabora una tabla o cuadro con tres columnas y tres filas (cuadro de Punnet):

211

En las celdas horizontales de color negro, van los alelos o genes aportados por el padre (en este ejemplo el padre tiene un par de genes AA para el color de la semilla) pero cada gameto solo recibe un gen para ese carácter por parte del padre. Entonces se coloca un gen A por cada celda, o sea, un gen para la formación de cada gameto en el cruce.

Esto se explica de acuerdo con la ley de la segregación Un par de genes es segregado (separado) en la formación de los gametos. En las celdas verticales negras se colocan los alelos o genes que aportará la madre a los gametos. De igual manera se cumple la ley de la segregación. Entonces en cada celda se coloca un solo gen: Las celdas de color blanco corresponden a los gametos de los hijos que se formarán en el cruce donde se restablecerá el número par de genes para cada gameto

212

Ejemplo: Si se cruzan semillas homocigotas amarillas dominantes AA con semillas verdes homocigotas recesivas aa, o sea que tenemos el caso AA x aa En las celdas blancas se formarán los gametos resultantes del cruce o sea la combinación o entrecruzamiento de los genes aportados por el padre y la madre para ese carácter (se combina el gen de la primera celda horizontal con el gen de la primera celda vertical). En este momento se restablece el número par de genes en lo gametos formados (uno de cada progenitor)

El resultado del cruce será: Genotipo: 100 % Heterocigoto Aa Fenotipo: 100% Semilla de color amarillo. (Ser puede explicar por la ley de la dominancia: un gen del par determina la expresión fenotípica y enmascara al otro; El polen de la planta progenitora aporta a la descendencia un alelo o gen para el color de la semilla, y el óvulo de la otra planta progenitora aporta el otro alelo para el color de la semilla; de los dos alelos, solamente se manifiesta aquél que es dominante (A), mientras que el recesivo (a) permanece oculto. Otro ejemplo. Si se toman semillas heterocigotas lisas Ll y se cruzan con semillas homocigotas rugosas ll. Ll x ll siguiendo el anterior procedimiento:

213

El resultado del cruce será Genotipo: 50 % Heterocigoto Ll Fenotipo: 50% semilla de forma lisa y 50% de semillas rugosas. Interpretación de las leyes de Mendel - Ejemplos de Cruces Primera ley de Mendel o Ley de la uniformidad de la primera generación filial (F1) o Ley de la Dominancia Cuando se aparean o cruzan organismos (fecundación) de raza pura (homocigotos) para un determinado carácter, todos los individuos de la primera generación son iguales. Ejemplo: Si se cruzan arvejas amarillas AA con arvejas verdes aa toda la F1 resultante del cruce será Aa de color amarillo. Aparece aquí el concepto de Dominancia y Recesividad.

Figura 137 Primera ley de Mendel imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Las arvejas amarillas AA son dominantes sobre las arvejas verdes aa recesivas. La primera generación o F1 es fenotípicamente amarilla y genotipícamente heterocigota Aa

214

imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Codominancia: La primera ley de Mendel se cumple también para el caso en que un determinado gen de lugar a una herencia intermedia y no dominante, como es el caso del color de las flores del "dondiego de noche" (Mirabilis jalapa). Al cruzar las plantas de la variedad de flor blanca con plantas de la variedad de flor roja, se obtienen plantas de flores rosas. La interpretación es la misma que en el caso anterior, solamente varía la manera de expresarse los distintos alelos

Figura 131 Primera ley de Mendel

La segunda ley de Mendel también llamada de la separación o segregación o disyunción de los alelos El experimento de Mendel: Mendel tomó plantas procedentes de las semillas de la primera generación del experimento anterior Aa y las polinizó entre sí. Del cruce Aa x Aa obtuvo semillas amarillas y verdes en la proporción 3:1. Así pues, aunque el alelo que determina la coloración verde de las semillas parecía haber desaparecido en la primera generación filial, vuelve a manifestarse en esta segunada generación. Interpretación del experimento. Los dos alelos distintos para el color de la semilla presentes en los individuos de la primera generación filial, no se han mezclado ni han desaparecido, simplemente ocurría que se manifestaba sólo uno de los dos. Figura 132 Segunda ley de Mendel imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Cuando el individuo de fenotipo amarillo y genotipo Aa, forme los gametos, se separan los alelos, de tal forma que en cada gameto sólo habrá uno de los alelos y así puede explicarse los resultados obtenidos

215

Retrocruzamiento En el caso de los genes que manifiestan herencia dominante, no existe ninguna diferencia aparente entre los individuos heterocigóticos (Aa) y los homocigóticos (AA), pues ambos individuos presentarían un fenotipo amarillo.

Figura 133 Retrocruzamiento

La prueba del retrocruzamiento, o simplemente cruzamiento prueba, sirve para diferenciar el individuo homo del heterocigótico. Consiste en cruzar el fenotipo dominante con la variedad homocigota recesiva (aa). Si es homocigótico, toda la descendencia será igual, en este caso se cumple la primera Ley de Mendel. Si es heterocigótico, en la descendencia volverá a aparecer el carácter recesivo en una proporción del 50%

imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Tercera ley de Mendel o de la herencia independiente de caracteres: Hace referencia al caso de que se contemplen dos caracteres distintos. Cada uno de ellos se transmite siguiendo las leyes anteriores con independencia de la presencia del otro carácter. El experimento de Mendel: Mendel cruzó plantas de guisantes de semilla amarilla AA y lisa BB con plantas de semilla verde aa y rugosa bb(Homocigóticas ambas para los dos caracteres

Figura 134 Tercera Ley Mendel

imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Las semillas obtenidas en este cruzamiento eran todas amarillas y lisas, cumpliéndose así la primera ley para cada uno de los caracteres considerados, y revelándonos también que los alelos dominantes para esos caracteres son los que determinan el color amarillo y la forma lisa. Las plantas obtenidas y que constituyen la F1 son dihíbridas (AaBb).

216

Segunda generación filial F2 Se cruzan entre sí plantas de la F1, teniendo en cuenta los gametos que formarán cada una de las plantas Los alelos de los distintos genes se transmiten con independencia unos de otros, ya que en la segunda generación filial F2 aparecen guisantes amarillos y rugosos y otros que son verdes y lisos, combinaciones que no se habían dado ni en la generación parental (P), ni en la filial primera (F1). Figura 135 Segunda generación filial http://www.biotech.bioetica.org/ap1.htm

217

Figura 136 Segunda generación filial Imagen tomada de http://www.biotech.bioetica.org/ap1.htm

Interpretación del experimento: Los resultados de los experimentos de la tercera ley refuerzan el concepto de que los genes son independientes entre sí, que no se mezclan ni desaparecen generación trás generación. Para esta interpretación fue providencial la elección de los caracteres, pues estos resultados no se cumplen siempre, sino solamente en el caso de que los dos caracteres a estudiar estén regulados por genes que se encuentran en distintos cromosomas. No se cumple cuando los dos genes considerados se encuentran en un mismo cromosoma, es el caso de los genes ligados.

218

Lección 24 Síntesis de proteínas Animación en Power Point Para la síntesis de proteínas se requieren: • Subunidades ribosómicas pequeñas y grandes • Cadena de ARN mensajero (ARNm), que es el portador de las instrucciones codificadas que especifican la secuencia de aminoácidos • ARN de transferencia (ARNt) Estos ARNt forman enlaces covalentes con los aminoácidos, con los que forman aminoacil ARNt, mediante reacciones catalizadas por enzimas específicos. Esto significa que a cada ARNt le corresponde su propio aminoácido. Cada ARNt contiene, además, un anticodón que reconoce el codón del ARNm que corresponde al aminoácido del que es portador. Todo este proceso de síntesis proteica o traducción a partir de una molécula de RNAm, requiere que previamente se haya producido la transcripción, mediante la cual a partir de una molécula de DNA se origina una de RNAm, que luego servirá de "molde" para la síntesis de nuevas proteínas. El proceso incluye las siguientes fases: Etapa 1: se fija un ARNm a la subunidad pequeña. El sitio P de la subunidad ribosomal pequeña queda ocupado por un ARNt de iniciación, cuyo anticodón reconoce el codón triplete AUG, que codifica al aminoácido metionina

219

Figura 137 Síntesis de proteína Etapa 1

de Etapa 2: la subunidad ribosomal grande se fija a la subunidad pequeña, y el ribosoma se desplaza a lo largo de la cadena de ARNm, en dirección desde 5' hasta 3', hasta que el siguiente codón queda alineado con el sitio A de la subunidad pequeña Etapa 3: un nuevo aminoacil ARNt (es decir, un ARNt que lleva un aminoácido) compara a su anticodón con el codón del RNAm; si concuerda, el ARNt se fijará sobre el sitio A

Figura 138 Síntesis de proteína Etapa 2 y 3

Etapa 4: los aminoácidos en los sitios A y P forman un enlace peptídico - El ARNt del sitio P pasa su aminoácido al ARNt del sitio A, que ahora tiene unidos sobre sí a los dos aminoácidos (proceso catalizado por la enzima peptidiltransferasa) Etapa 5: el ARNt desaminado deja libre el sito P, y el ARNm con sus dos aminoácidos se mueve desde el sito A hacia el sitio P. Al mismo tiempo, el

220

ribosoma se desplaza a lo largo de la cadena de ARNm hasta que el siguiente codón queda alineado con el sitio A de la subunidad ribosomal pequeña Etapa 6: se repiten las etapas 3 a 5, con lo que se alarga la cadena polipeptídica hasta que se llega al codón de terminación (que pueden ser tres: UAG, UAA o UGA), responsable de detener el proceso de traducción Etapa 7: cuando el sitio A de la unidad ribosomal pequeña llega a un codón de terminación, se fija en el sitio A un factor liberador, encargado de descargar a la cadena polipeptídica recién formada desde el sitio ARNt del sitio P hacia el citosol Etapa 8: el ARNt se libera desde el sitio P, el factor liberador se libera desde el sito A, y las subunidades ribosómicas grande y pequeña se disocian del ARNm quedando libres en le citosol.

Figura 139 Síntesis de proteína Etapa Terminación

En definitiva, los ribosomas participan en la síntesis de las proteínas que tendrán un destino u otro según que sean formadas por ribosomas libres o por polirribosomas adheridos a las membranas del Retículo endoplasmático rugoso

Figura 140 Esquema de los ribosomas en la sístesis de proteína

221

Capitulo 2 Biotecnología Lección 26. Los pasos de la ingeniería genética http://www.agronort.com/informacion/abcbiotec/abcbio4.html El ADN sirve como molde para la síntesis del ARN 1. Una de las bases del ARN es diferente A (ADN) se complementa con U (ARN) T (ADN) se complementa conA (ARN) G (ADN) se complementa con C (ARN) C (ADN) se complementa con G (ARN) 2. Una secuencia del ADN, llamada promotor, le ordena a la célula comenzar a construir ARN mensajero, a partir del gen que le sigue.

3. Luego, cabeza y cola, se agregan al ARNm antes de dejar el núcleo.

4. El ARNm terminado puede ahora servir de molde para la correspondiente proteína. El Código genético Traducción de ARN en proteína 1. Cada tres bases en el ARN, forman un codón correspondiente a ciertos aminoácidos.

222

2. La mayoría de los aminoácidos pueden ser codificados por mas de un codón. Aac. Aac. Cisteina Prolina Histidina

codones UGU,UGG CCU,CCC,CCA,CCG CAU,CAC

Stop= UAA, UAG, UGA 3. También hay codones, que ordenan a la maquinaria de la célula, detener la síntesis de la cadena proteica. 4. Todo este proceso es llevado a cabo por estructuras complejas, llamados ribosomas, junto con enzimas y moléculas especiales de ARN. Construcción de una Proteína: Traducción del ARNm

1. Los ribosomas se mueven a lo largo del ARNm y van adosando los aminoácidos correspondientes a cada codón. 2. Los aminoácidos se unen entre si por ligaduras de péptidos.

223

3. La cadena proteica toma una forma tridimensional, basada en la secuencia particular de aminoácidos. 4. Esta forma particular, es la que le confiere propiedades y funciones únicas. Resumen: Pasos desde ADN a Proteína 1. Un gen es parte del ADN, en un cromosoma. 2. El código genético es "transcripto" en el ARN mensajero. 3. El ARNm forma una cabeza y una cola para dejar el núcleo. 4. El código en el ARNm es traducido, construyendo las largas cadenas de aminoácidos que forman una proteína. 5. La proteína se organiza en su forma funcional. Los pasos de la Ingeniería Genética 1. Identificar un carácter deseable, pero que no pueda ser manejado por los métodos clásicos de mejoramiento. 2. Encontrar algún organismo que lo exprese. 3. Encontrar el gen responsable del carácter deseado, en dicho organismo. 4. Combinar dicho gen con otros elementos necesarios para que este sea funcional en la planta. 5. Mover los genes a las células de la planta. 6. Encontrar las células modificadas exitosamente, y regenerarlas en plantas completamente funcionales.

224

Posibilidades de la Biotecnología Ejemplos Caracteres de Protección Resistencia a Insectos Tolerancia a Herbicidas Resistencia a Hongos Resistencia a Virus Resistencia a Bacterias Resistencia a Nematodos

Caracteres de Calidad Demora de la maduración Aceites modificados Proteínas modificadas Alto contenido de sólidos Producción vegetal de anticuerpos, enzimas, etc. Búsqueda de fuentes para genes deseados

Búsqueda de fuentes para genes deseados

1. La bacteria de suelo, Bacillus thuringiensis (Bt), tiene genes para diversas proteínas, selectivamente toxicas para ciertos insectos.

2. El actinomycete de suelo, Streptomyces tiene un gen para una enzima que desdobla la molécula del Glufosinato de Amonio (herbicida).

3. Una línea mutante de Arabidopsis thaliana, tiene un gen para una versión de la enzima EPSPS, menos sensible al Glifosato

225

Herramientas Básicas Enzimas "para cortar y pegar" 1. Las enzimas de restricción cortan ADN, solo en ciertas secuencias especificas. 2. Muchas dejan "extremos pegajosos", de manera que otras piezas cortadas con la misma enzima, se ligan automáticament e. 3. El "extremo pegajoso" de una pieza puede hibridar con el de otra pieza, cortada por la misma enzima. 4. Otras enzimas llamadas ligasas, terminan las uniones.

226

Clonado

1. Además de su principal cromosoma, muchas bacterias tienen también pequeñas piezas circulares de ADN, llamadas plásmidos. Estos tienen a menudo, genes de resistencia a antibióticos.

2. Los plásmidos son fáciles de manejar en tubos de ensayo, para "cortar y pegar" nuevas piezas de ADN

3. Los plásmidos modificados, pueden ser colocados de nuevo en la bacteria, y serán copiados en cada duplicación celular.

227

4. De esta forma es posible obtener un gran numero de copias del gen, tan solo incrementando la bacteria.

228

Capturando el Gen

Tomar la pieza de ADN buscada desde el organismo donante 1. Se extrae ADN de muchas células, y se corta en pequeñas piezas.

2. Las piezas se mezclan con plásmidos cortados con la misma enzima, las cuales al conjugarse conforman distintos plásmidos.

3. Los plásmidos, colocados de nuevo en bacterias, son ahora distintos, y entonces pueden ser separados. 4. Ahora, cada pieza de ADN puede copiarse tanto como sea necesario.

Encontrando el Gen correcto

1. Los plásmidos usados en la bacteria (vectores clonados), también contienen un gen de resistencia a antibióticos, de manera que solo aquellas que tengan el nuevo plásmido recombinante, crecerán en el medio de cultivo. Este gen se llama "marcador selectivo".

229

2. Cada clon (progenie de bacterias con la nueva secuencia de ADN), puede ser probada para saber si contiene el gen deseado. Hay diversas maneras, dependiendo del carácter en cuestión

Lo que acompaña al Gen La construcción 1. Los genes deben "estar prendidos" para expresarse; para eso se usa el promotor.

3. Es necesario saber cuales (poco frecuentes) células han sido modificadas; para eso se agrega un gen marcador selectivo. 4. La combinación terminada del gen + promotor + marcador selectivo + terminadores, se llama construcción o inserto.

230

Promotores: dónde se "prenderá" el gen? 1. Para que el ADN transcriba el gen en ARNm, debe haber un promotor delante de la secuencia.

2. Algunos promotores activan el gen en casi todas las células de la planta (Pr. Constitutivos).

3. Algunos solo lo hacen en las partes verdes.

4. Otros promotores solo trabajan en tejidos específicos, como polen, raíz o tejidos dañados.

Marcadores Selectivos 1. El tipo mas común es el de un gen que codifica para una enzima, que desdobla algún antibiótico o componente del herbicida. 2. El gen marcador también necesita un promotor y terminador. nptll -------------->kanamicína bar -->glufosinato de amonio

231

3. Normalmente la planta moriría ante el químico. Solamente sobrevivirá si ha sido exitosamente modificada para poseer esta enzima. Inserto listo para ser transferido a una planta

Lección 29 Transfiriendo los genes a las plantas. Opciones de Transformación. Métodos 1. Agrobacterium. Uso de una bacteria como "Ingeniero Genético Natural". La bacteria conteniendo el inserto, infecta las células de la planta produciendo la recombinación genética.

232

2. Acelerador de Partículas (Gene Gun). Un cañón artificial bombardea micropartículas con el inserto, sobre la célula. 3. Electroporación. Uso de carga eléctrica para que el ADN atraviese la membrana nuclear. La corriente, fuerza el paso de los insertos al interior del núcleo. 4. Polietilenglicol. La exposición de las membranas al PEG, facilita el movimiento de las moléculas de ADN. 5. Silicon Wiskers. Inyección mediante fibras microscópicas. Las fibras atraviesan las membranas, llevando los insertos. Transformación por Agrobacterium Fundamentos 1. El patógeno de suelo Agrobacterium tumefaciens, naturalmente inserta su ADN (plásmido Ti), en las células expuestas de sus huéspedes, en tejidos radiculares dañados. 2. Este ADN extraño se incorpora y recombina con el ADN propio de la planta huésped, dividiéndose y creciendo al azar, como un tumor. 3. El ADN de Agrobacterium toma el control de las células del tumor, causando la síntesis de aminoácidos inusuales que sirven de soporte nutricional a la bacteria.

Preparando un gen para una transformación mediante Agrobacterium 1. Las secuencias del plásmido Ti, responsable de la virulencia de la bacteria, se remueven (vírgenes).

233

2.En otra bacteria, se ubica el gen deseable, entre las dos secuencias de borde del plásmido Ti.

3. Se integra el inserto que contiene el gen deseable, dentro del plásmido Ti, al ser incorporado nuevamente dentro del Agrobacterium. 4. Bacteria clonada, lista para transformar.

Resumen Transformación mediante Agrobacterium 1. Armar dos construcciones; una con los genes a incorporar (gen principal y marcador), y otra con las secuencias necesarias del plásmido Ti. 2. Integrar todo esto en un solo plásmido, en Agrobacterium, y usar este clon para infectar tejido vegetal. 3. Exponer el tejido tratado al agente químico selectivo (antibiótico o herbicida). Solo las células exitosamente transformadas, sobrevivirán. 4. Usar métodos de cultivo de tejidos para regenerar plantas viables de las pocas células sobrevivientes. Transformación por Acelerador de Partículas (Gene Gun) 1. Incorporar el inserto en un plásmido y hacer un gran numero de copias en una bacteria.

234

2. Extraer los plásmidos y cubrir con ellos pequeñas partículas de tungsteno (1 micrón). 3. Disparar las partículas mediante una explosión, sobre los tejidos.

4. Exponer las células al agente selectivo para regenerar aquellas exitosamente transformadas. Porque un evento de transformación es raro y costoso? 1. En todo el proceso hay muchos pasos "poco probables" involucrados, debido a los siguientes obstáculos: Tener que introducir ADN en células vivas. Lograr que el ADN sea insertado en forma estable, en los propios cromosomas de las células, haciendo viable su replicación. Lograr que esta inserción sea funcional 2. No hay forma de controlar adonde se ubicara el ADN extraño: Podría

no

ser

funcional,

dependiendo

del

sitio

de

inserción.

Podría afectar o anular la acción de algún gen importante de la planta. Lección 30 Los primeros desafíos Tolerancia a Glifosato Objetivo: Transformar plantas sensibles en altamente tolerantes, para su aplicación directa.

235

Origen: El Glifosato inhibe una enzima vegetal (EPSPS), necesaria para el crecimiento celular Intento 1: Adicionar una nueva copia del gen para EPSPS, de petunia, con un promotor fuerte, para aumentar la concentración de EPSPS en la planta, y lograr tolerar mayores dosis de Glifosato. Resultado 1: Aun con mas EPSPS, las plantas fueron todavía muy sensibles, como para ser de interés comercial. Tolerancia a Glifosato: 2do Intento Objetivo: Generar mutantes de algún organismo fácil de cultivar, hasta hallar algún individuo tolerante a Glifosato. Intento 2: Un aislamiento de Agrobacterium resulta menos sensible, pero su EPSPS es aun funcional; se la transfiere a plantas TG. Resultado2: En soja, ambos mecanismos sumados funcionan adecuadamente, no así en maíz, que requiere trabajo adicional. Tolerancia a Glifosato: 3er Intento Objetivo:Encontrar un microorganismo que produzca una enzima capaz de detoxificar la molécula de Glifosato (GOX de Achromobacter sp.). Intento 3: Juntar los efectos del gen para esta enzima con el gen mutante de EPSPS, en plantas de maíz. Resultado 3: Este intento, involucrando ambos genes resulto efectivo, logrando que las plantas estén protegidas por producir EPSPS insensible al herbicida, mas la capacidad de detoxificar parte del mismo. Tecnología Bt Objetivo: Lograr que la planta produzca su propio insecticida. Origen: Algunos insectos pueden ser controlados mediante la aplicación de Deltaendotoxinas de Bacillus thuringiensis. Estas toxinas son altamente selectivas e inocuas para el hombre y el ambiente, pero se desdoblan rápidamente cuando están expuestas a la luz ultravioleta. Intento 1: Poner el gen completo para la toxina-proteína en la planta, con un fuerte promotor que funcione en todos los tejidos.

236

Resultado 1: Aun con una transformación exitosa, la planta no producía suficiente proteína para protegerse a si misma. Tecnología Bt: 2do Intento Origen: Cuando la toxina natural (potoxina) entra en el intestino del insecto, se desdobla en la toxina activa, de cadena mas corta, por acción de las enzimas del insecto. Intento 2: Insertar un gen truncado que solo codifique para la porción de la proteína correspondiente a la toxina activa. Resultado 2: La planta produce mucho mas toxina ahora, pero seria conveniente aun mas. Tecnología Bt: 3er Intento Origen: La planta "prefiere" usar ciertos codones para algunos aminoácidos. Cuando no tiene estos codones "preferidos" produce mucha menos proteína. Muchos de los codones en un gen bacterial, no son los "preferidos", por lo tanto el gen no se expresa bien en la planta. Intento 3: Realizar cambios en el ADN del gen, base por base, de manera que codifique para los mismos aminoácidos, pero usando los codones "preferidos". Original TTAGCACCCTAGGCTAGCGTA Modificada TTACCACCCTACGCTAGCCTA Resultado 3: Cuando el gen es trucado y además tiene los codones "preferidos", expresa suficiente toxina para su autoprotección. Links http://www.agronort.com/links.html#Biotecnología EL PROYECTO GENOMA HUMANO Aspectos científicos USDA - Novedades, regulación, etc... Plant Genome Information Resource Intercambio información s/ cultivo de tejidos - Texas A&M

237

Regulación (OECD, IANB, G-VIII) Biotecnología Aplicada - conceptos elementales, ética, etc.. Recursos y herramientas de biología molecular Portal "porque biotecnología" de A.S.A. (Asociación Semilleros Arg.) Checkbiotech.org - Información y novedades de biotecnología National Center for Biotechnology Information Council for Biotechnology Information Glosario de términos de la Biotecnología Genetic Engineering News Galería Figura de procesos relacionados a la biotecnología Ag BioTech InfoNet Transgenic crops (Colorado State U.) agbios Agriculture & Biotechnology Strategies Inc. (Canada) AgBioForum - Economía y gerencia, en biotecnología agrícola. Biotecnología Agrícola y Pobreza Electronic Journal of Biotechnology - Universidad Católica de Valparaíso

238

UNIDAD 3. ECOLOGÍA Y EVOLUCIÓN Capitulo 1 Ecología Lección 31

Figura 141 Flujograma Ecologia

Ecología. La disciplina ecológica partió de la concepción aportada por Ernst Haeckel en relación con la organización de los seres vivientes que comparten un territorio y se adaptan al ambiente con diversas estrategias o mecanismos. Por este motivo, el término ecología retoma etimológicamente el significado de “oikos” que es casa y “logos” que se puede definir como estudio o tratado. La vida compartida en un mismo territorio obliga a los organismos a organizarse socialmente y de tal manera que aseguren un rol ante las otras especies. La organización interespecífica en un mismo ambiente se clasifica con las siguientes categorías:

239

Ecosistema. Es la unidad básica de estudio ecológico y se define como el espacio físico donde las comunidades de seres vivos interactuantes, denominadas comunidades bióticas, asumen roles en el uso de recursos, compiten o cooperan de tal forma que mantienen un equilibrio dinámico favorable a la supervivenci Comunidad biótica Es la suma de poblaciones que comparten el ecosistema. Población. Es la suma de individuos de una especie ligada al espacio del ecosistema. En síntesis, la ecología aborda el estudio de las relaciones intra e interespecíficas de las comunidades de seres vivos que comparten un ecosistema al cual se adaptan de una forma dinámicamente equilibrada. La importancia de estudiar ecología radica en conocer el tipo de relaciones que mantienen el equilibrio ecosistémico, con el fin de tener criterios científicos para la preservación del ambiente. En el mapa conceptual sobre ecología se resume cómo los organismos agrupados en comunidades en se adaptan al medio ambiente, mediante formas de aprovechar los recursos en un equilibrio dinámico articulado a cadenas tróficas.

Diferenciación de los organismos de los ecosistemas.

En ecosistemas suficientemente grandes, siempre se distinguirá y con facilidad: 1. Los organismos productores como las plantas o la microflora del lugar que se sustentan de la luz, el suelo o el agua;

2. Los organismos consumidores que son los animales, divididos en consumidores primarios que ingieren vegetales y consumidores secundarios que son los carnívoros; 3.Los organismos descomponedores o saprófitos como los hongos y las bacterias; 4. La fracción inorgánica que suministra sustancias utilizadas de alguna manera por los seres vivos de la unidad ecosistémica.

240

Biocenosis y biotopo La unidad ecosistémica se subdivide en biocenosis y el biotopo. El espacio del ecosistema donde se establecen las comunidades vivientes interrelacionadas se denomina biotopo. Ejemplo, un manglar, una pradera. Las comunidades alojadas equilibradamente en un biotopo, se denominan biocenosis y pueden subclasificarse como fitocenosis (comunidades vegetales), zoocenosis (comunidades animales) y microbiocenosis (comunidades de microorganismos).

Hábitat y nicho ecológico Toda región, amplia o pequeña que delimita con precisión dónde viven las poblaciones de un organismo, se denomina hábitat. Ejemplo, una isla, un continente. El rol que asume un organismo determinado para procurarse su sustento y prosperar dentro de un hábitat en la unidad ecosistémica, se llama nicho ecológico. El nicho ecológico es la suma de factores físicos, químicos y bióticos que deben concurrir para que un organismo pueda sobrevivir. En otras palabras, al estudiar un nicho ecológico se sabrá qué come un organismo, hasta donde puede extenderse dentro del ecosistema, qué predadores lo amenazan, cómo afecta a otros organismos y a la parte abiótica de su entorno. Una especie puede emigrar hacia otro nicho ecológico cuándo se agotan los recursos o hay demasiados competidores. Otras especies que tienen cambios en su ciclo biológico pueden cambiar de nicho según su hábito alimenticio. Por ejemplo una larva de insecto puede vivir en un estanque y al llegar a ser un insecto adulto puede asociarse a determinada especie vegetal para su manutención.

Funcionamento del ecosistema Todos los ecosistemas presentan un ciclo de energía a partir de la luz solar, o en algunos casos de energía geotérmica en el fondo del mar, ciclos de minerales (ejemplo ciclo del carbono, ciclo del nitrógeno, etc.), cadenas tróficas (en cada

241

cadena alguien consume algo del nivel inferior), hasta que finalmente después de la muerte de los seres vivos del ecosistema, se recicla la materia orgánica para uso de detritívoros y de los productores primarios. La materia presenta un ciclo circular. La energía lumínica pasa a energía química y asciende linealmente entre los niveles de las cadenas tróficas. En el siguiente mapa conceptual sobre ecosistemas se resume e funcionamiento del ecosistema al analizar las relaciones alimentarias , el ciclo de energía y el ciclo de la materia El estudio ecológico se enfoca en las relaciones entre las comunidades de una unidad ecosistémica, o sea en el papel de cada organismo para la estabilidad del ecosistema. De esta manera, una investigación ecosistémica debe abordar las relaciones alimentarias, el efecto de los ciclos de la materia y la eficiencia de los flujos de energía.

242

Relaciones alimentarias. La vida necesita un aporte continuo de energía que llega a la Tierra desde el Sol y pasa de unos organismos a otros a través de la cadena trófica.

Gráfica Ejemplo de cadena trófica Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm La figura ilustra como existe una articulación de cadenas tróficas en la unidad ecosistémica. El conjunto de esas cadenas constituye la red alimentaria. Ejemplo: La planta (productora primaria) consume energía solar. Los herbívoros (consumidor primario) consumen plantas que aportan energía química. Los carnívoros (consumidor secundario) consumen herbívoros. Los organismos detritívoros o descomponedores consumen lo que queda de los organismos muertos de las anteriores cadenas tróficas. Una cadena alimentaria puede tener dos eslabones (hierba-conejo) o hasta 5 eslabones (vegetal-insecto-pájaro, serpiente-mangosta-leopardo).

243

Redes tróficas. La dieta de los diversos consumidores puede ser variada, razón por la cual las cadenas alimentarias no siempre son lineales sino normalmente en red, como se puede observar en la siguiente figura:

Gráfica Red trófica Tomada de: http://www.jmarcano.com/nociones/trofico2.html Pirámides biológicas Para realizar cálculos de biomasa y energía, es útil representar las cadenas tróficas en forma de pirámides, como se observa en la siguiente figura:

Gráfica Pirámide de energía de una cadena trófica acuática tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

244

Biomasa y energía. La materia viviente de una cadena trófica o de uno de sus niveles, se expresa en gramos de carbono de la materia seca correspondiente. La comparación de la biomasa producida en determinado tiempo versus la biomasa inicial, permite hablar de productividad del ecosistema. Pirámide de energía. Al pasar la energía de un eslabón de la cadena al siguiente, pierde algo de la carga inicial o sea que no hay eficiencia del 100% en el flujo energético. En general, se asume que entre un nivel y otro sólo pasa el 10% de la energía recibida del nivel inferior. Flujo de energía. La energía se transforma al pasar entre los niveles tróficos, sea en calidad o en cantidad: pasa de la luz solar a la biomasa vegetal como energía química, luego a la biomasa animal y de los descomponedores y finalmente se disipa como energía calorífica que se difumina en el ambiente. La energía se consume linelmente. En cambio los elementos químicos vuelven a recorrer un ciclo nuevo entre los niveles tróficos, indefinidamente

Ciclos de la materia En los ecosistemas encontramos ciclos: del oxígeno, del carbono, del hidrógeno, del nitrógeno, del agua y del fósforo, los cuales atraviesan las diversas cadenas tróficas como parte de las biomasas producidas y consumidas.

245

Gráfica. Ciclo energético del ecosistema Tomada de: www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Productividad de los ecosistemas como base para la intervención humana sostenible El cociente entre los nutrientes ingresados a los componentes de un nivel trófico y la biomasa producida, se denomina productividad, o sea corresponde a la eficacia con que un organismo aprovecha los recursos tróficos. Cuándo se utiliza la productividad para medir la eficacia de un ecosistema, se habla de ecoeficiencia y puede medirse en peso de la biomasa producida por área y por año.

Relaciones entre individuos Relaciones intra-específicas Los individuos de una misma especie dentro de un hábitat y de un nicho ecológico, desarrollan relaciones intraespecíficas para organizar su reproducción, cría, protección de comunidad y gestión de alimentos.

246

Hay relaciones intraespecíficas de sólo cooperación,y en otros casos, como en animales carnívoros solitarios, puede haber competencia en lugar de cooperación. Ejemplos de cooperación son las colonias y las sociedades. Cuándo los individuos ceden su autonomía individual para preservar mediante funciones especializadas su comunidad, se habla de colonia. Por ejemplo, una colonia de pólipos de coral, donde unos capturan alimento mientras otros los defienden con sus estructuras urticantes y otros se encargan de la reproducción. En el caso de las hormigas, abejas y otras especies de animales, se organizan sociedades donde se distribuye de manera estricta el rol de cada individuo, sea para trabajo, exploración, combate, recolección de alimento, aseo, etc. De esta manera, las sociedades aseguran su supervivencia. Algunas plantas superiores se asocian para crear condiciones más favorables. Por ejemplo, las formaciones casi exclusivas de un bosque de pinos o de eucaliptos.

Relaciones ínter-específicas Entre las especies puede haber relaciones de competencia o de cooperación según condiciones específicas: Simbiosis. La especie A ayuda a la especie B y viceversa y sólo sobreviven gracias a este convenio. Ejemplo, hay bacterias nitrificantes que se asocian a las raíces de unas plantas leguminosas. De esta manera, las bacterias capturan nutrientes del suelo para la planta y esta les suministra sustancias nutritivas a las bacterias. Mutualismo .Es un caso de simbiosis con beneficio mutuo de las dos especies. Ejemplo, hay bacterias nitrificantes que se asocian a las raíces de unas plantas leguminosas. De esta manera, las bacterias capturan nutrientes del suelo para la planta y esta les suministra sustancias nutritivas a las bacterias. Comensalismo. Es una modalidad de simbiosis donde una especie aprovecha aportes de la otra sin perjudicarla en nada. Ejemplo: hay peces que se asocian a determinados tiburones para acompañarlos anclados a su piel mientras consumen los restos de la comida del tiburón. Entre otras relaciones particulares posibles, tenemos:

247

Parasitismo.Un organismo pequeño se alimenta durante su ciclo de vida de sustancias de un organismo grande al cual perjudica en cierto grado. Ejemplo, las garrapatas del ganado Depredación. Un organismo se alimenta de otro al cual depreda. Ejemplo, los leopardos se comen a los venados Amensalismo. Se presenta cuándo una especie crea condiciones que impiden el crecimiento o la supervivencia de otra. Ejemplo, el hongo productor de la penicilina inhibe el crecimiento de otros microorganismos.

Atributos de las poblaciones Se denomina población a organismos de una especie que ocupan un área determinada y sobreviven gracias a su agrupamiento y relaciones intraespecíficas e interespecíficas.

Las poblaciones se caracterizan por ciertos índices: Natalidad (nuevos individuos por unidad de tiempo), Mortalidad (nuevos muertos por unidad de tiempo), Densidad (número de individuos por unidad de superficie o de volumen), Curva de crecimiento (incremento de individuos en un periodo de tiempo), Potencial biótico (capacidad de crecimiento en condiciones ambientales óptimas), Resiliencia o capacidad de resistencia a ambiente hostil (diferencia entre el potencial biótico y el crecimiento en condiciones desfavorables).

248

Tabla Niveles de Integración de los materiales biológicos en los ecosistemas Los materiales biológicos (proteínas, lípidos, ácidos nucleicos, etc.) se integran en la naturaleza en un cierto número de niveles de organización cada vez más complejos: célula - individuo - población - comunidad. La célula es la unidad biológica funcional más pequeña y sencilla. Está compuesta por un territorio protoplasmático, limitado por una membrana plasmática (de lípidos y proteínas), reforzada en los vegetales por una pared celular. El protoplasma está constituido por una solución coloidal de proteínas muy estructurada (citoplasma), en cuyo seno se encuentra el material genético (ADN, ARN), organizado generalmente en un núcleo, y toda una serie de orgánulos (mitocondrias, ribosomas, plastos, etc.) que constituyen la maquinaria metabólica. El individuo (organismo) es un sistema biológico funcional que, en los casos más simples, se reduce a una sola célula (unicelular), pero que, en principio, está compuesto por numerosas células, que pueden estar agrupadas en tejidos y órganos. Un individuo se caracteriza por su anatomofisiología y su metabolismo. En un momento dado, un individuo posee una determinada biomasa que se puede expresar en peso vivo (fresco) o en peso de materia seca. La población (o demo) es un sistema biológico formado por un grupo de individuos de la misma especie que viven en un lugar determinado en un momento determinado. Aproximadamente, la especie es un conjunto de individuos semejantes que transmiten este parecido de generación en generación. La comunidad (o biocenosis) es un sistema biológico que agrupa el conjunto de poblaciones habitantes de un mismo lugar determinado, en unas condiciones dadas del medio y en un momento concreto. El ecosistema, lo constituyen las relaciones e interdependencias de las comunidades integradas conjunta y sinérgicamente en su medio. La biosfera es el conjunto de los ecosistemas naturales desarrollados en el seno de los mares o en la superficie de los continentes. La noosfera representa la integración virtual del pensamiento humano sobre la biosfera, crecientemente tecnologizada.

249

Gráfica. Niveles de organización en la naturaleza Tomada de www1.ceit.es/.../Ecologia/Hipertexto/ 04Ecosis/100Ecosis.htm

Aplicaciones para conservación de la biodiversidad

El hombre con sus prácticas ecológicas no sostenibles ha transformado el ambiente, originando grandes desequilibrios de los ecosistemas, causando desastres ecológicos que ponen en peligro la vida. Los recursos naturales renovables como la biodiversidad (flora y fauna) los bosques y los recursos no renovables como los yacimientos minerales, los

250

combustibles fósiles y nucleares deben ser manejados de manera racional y sostenible para su conservación y sus beneficios.

Algunas acciones conducentes a la conservación de la biodiversidad * Estratificación y diversificación de cultivos. * Evitar la tala de bosques para detener la erosión y la extinción de especies amenazadas. * Sustituir el control químico de plagas con el control biológico. * Uso de energías alternativas * Evitar o por lo menos establecer vedas para la caza y la pesca * Reciclar las basuras * Incrementar las áreas de parques naturales y de reservas forestales. * Colaborar con los laboratorios de bancos de germoplasma de plantas, de animales y de microorganismos . * No contaminar los suelos ni el agua. * hacer rotaciones de poteros y de cultivos. * Eliminar el consumo de aerosoles o clorofluorocarbonados que destruyen la capa de ozono * Disminuir la huella de carbono * Evitar el uso hogareño e industrial de detergentes y sustancias no biodegradables.

La misión del ecólogo El ecólogo debe ser un investigador de las relaciones interespecíficas de las cuales depende el equilibrio ecosistémico. Debe asesorar a las comunidades sobre la prevención de los riesgos ambientales.

251

Puede generar modelos de excelente administración ambiental para preservar la biodiversidad. En síntesis: prevenir deterioros ambientales, potenciar las resiliencias de los ecosistemas y mantener buenos índices de ecoeficiencia, con aportes teóricos y técnicos para la productividad limpia. Lección 39. Pensamiento Sistémico y Desarrollo Sustentable Tomado de: Congreso Internacional NIKAN Honorato Teissier Fuentes (*) Nota: El conocimiento de los ecosistemas habilita al estudiosos para comprender la posisción epistemológica del pensamiento sistémico, como un aporte de la biología a la conceptualización ambiental del desarrollo sostenible, comenzando por el manejo de los agroecosistemas, que no son otra cosa que la intervención productiva del hombre en los ecosistemas . Para reflexionar sobre este enfoque de pensamiento sistémico biológico es interesante revisar el texto tomado de Honorato Teissier Fuentes La Era Industrial y la Naturaleza No cabe duda que la industrialización aportó gran parte del desarrollo humano en los últimos doscientos años. Sin embargo ha traído consigo una gran cantidad de aspectos negativos.La era industrial requirió del individuo, la tecnología y las materias primas para la producción masiva. No obstante de haber sido pensada para beneficio del hombre, ésta lo volvió su esclavo, convirtiéndolo en un engrane más de su mecanización. La forma fragmentada de pensar, que contiene al enfoque mecanicista, también generó una desintegración del mundo. Las materias primas, productos de la Naturaleza, se volvieron sólo la entrada para el insaciable hambre de riqueza industrial y la ambición del poder de los gobiernos.Bajo esta visión analítica, divisionista, lineal y fragmentada hemos llegado a los niveles de deterioro del Planeta que hoy observamos. Descomponer un sistema es lo mismo que destruirlo. No sólo implica la separación de sus partes, sino la anulación de sus propiedades: el agua, separada en oxígeno e hidrógeno deja de ser el compuesto que ayudó a formar la vida en la Tierra, no es más un sistema. El concepto de Sistema, a pesar de lo antiguo del vocablo, pues los griegos lo acuñaron, como visión social es una idea reciente. Es una base que contiene la posibilidad de apreciar El Todo sin desintegrar sus partes para tratar de

252

entenderlas o controlarlas. Plantea un conjunto de modelos mentales que se distinguen del pensamiento analítico, punto de partida del enfoque mecanicista. El pensamiento sistémico requiere percibir más que medir. Obliga a sintetizar antes de analizar, pero además fuerza a observar al sistema como parte interactuante con otros sistemas de su mismo nivel, y como integrante de sistemas superiores, en donde se encuentra inmerso. Implica comprender que todo tiene relación, interna y externa, por remota o distante que sea. Por otro lado, el Desarrollo Sustentable plantea armonizar las relaciones entre el hombre y la naturaleza. Quisiéramos ver a la raza humana tomando del río sólo el agua que necesita para saciar su sed, so pena de que aquel nunca más le dé de beber. El modelo del desarrollo sustentable que se pretende alcanzar, requiere de un cambio de paradigma y no sólo de las buenas intenciones. Esto es, requiere de un cambio mental en la visión del hombre. Primero porque necesitamos quitar de nuestra mente las viejas ideas de que la Naturaleza está en contra del Hombre y de que hay que "vencerla". Segundo, de que debemos dominarla y controlarla, pues ésta tiene fuerzas y formas propias. Tercero, de que nos pertenece y son nuestros sus productos. Y cuarto, de que posee recursos ilimitados, sólo para una ilimitada hambre de poder humano. Para ello, será necesario comprender las relaciones, directas e indirectas que existen entre los ecosistemas naturales y los humanos, base del respeto que pretendemos lograr hacia las fuentes de la vida en la Tierra. También será indispensable sustituir nuestras formas de vida "progresistas" de manejo del entorno, en aras de las cuales destruimos todo lo que podemos. Todo esto finalmente podría acercarnos a un desarrollo en armonía con la Naturaleza, un Desarrollo en la Sustentabilidad. El pensamiento sistémico y el desarrollo sustentable En el Pensamiento Sistémico se encuentran las características requeridas para formar una sociedad que comprenda la necesidad de respetar y cuidar los recursos naturales, de no desperdiciar la energía, de acrecentar su acervo de conocimientos y de lograr la equidad, no sólo entre los pueblos del mundo, sino entre todos los seres vivos del Planeta y, de poder ver el futuro como algo promisorio para todas las generaciones venideras. Esta forma de pensar nos obliga a ver los distintos horizontes de tiempo, donde podemos ubicar nuestra vida, nuestro país, nuestro continente y nuestro planeta. Implica ver comportamientos y sus estructuras causales, como vía para inducir cambios en los sistemas. Con todo ello podemos comprender "el todo", aunque no pudiéramos ver o entender sus partes. Lo haríamos sin necesidad de descomponerlo. Evitaríamos tener que pensar en soluciones mágicas como la de

253

que al reducir la sobrepoblación se acabarán los problemas, puesto que existen muchas más relaciones sistémicas. Al llevar poco a poco esta forma de pensar a nuestra vida diaria modifica la forma de ver las cosas y genera inquietudes e incomodidad, en un principio. Es común que se lleguen a poner en discrepancia nuestras actividades con el modelo de sustentabilidad? Sí. Pero será indispensable pasar por ese enfrentamiento interior en cada uno de nosotros, para iniciar el camino del Desarrollo Sustentable. No se pueden concebir cambios en la comunidad si no hay cambios en los individuos. El Pensamiento Sistémico, como modelo mental, además está poniendo en tela de juicio varios de los paradigmas con los que hemos vivido hasta hoy. Entre ellos el del método científico. Será ya tiempo de renovar estos modelos ?. Para terminar, recordemos la expresión del Jefe Seatle, de los indios norteamericanos:El hombre no tejió la trama de la vida, es sólo un hilo de ella. Propuesta Dada la complejidad de los problemas ambientales, de sostenibilidad de los recursos naturales, y de la preservación de los ecosistemas, el Pensamiento Sistémico es uno de los caminos que tenemos más claros, al menos en el presente, para conducirnos hacia lo que sería una sociedad sustentable. Proponemos que el Pensamiento Sistémico sea utilizado como herrameinta para avanzar hacia la sustentabilidad de nuestros sistemas humanos. Honorato Teissier Fuentes Una contribución de la Universidad Autónoma de Coahuila, al Congreso Internacional NIKAN, celebrado en Quebec,Canada. Saltillo, Coahuila, México, Septiembre de 1997 [email protected] Referencias 1.- Senge, Peter M., La Quinta Disciplina (Ed. Español), Ed. Granica, 1990. 2.- Aranda A. Armando, Los límites del reduccionismo molecular Revista Ciencia y Desarrollo, CoNaCyT, Jun 1994, pp 18-25. 3.- Hugunin, Carol, "It´s Time me to bury Darwin Revista 21´st. Century, USA,. Primavera de 1995, pp 32-45. 4.- Meadows, Dennis y Donella, Más alla de los límites del crecimiento, Ed. El País

254

Aguilar, Madrid, España, 1992. 5.- Nava Roberto, Gastó Juan, Armijo Roberto, El Ecosistema UAAAN, Saltillo, Coah., México, 1978. 6.- Estrada Alejandro y Coates-Estrada Rosamond, Las Selvas de los Tuxtlas, Veracruz. Ciencia y Desarrollo, CoNaCyT, México, May-Jun. 1994, pp 50-61. 7.- Cereijido Alejandro, Del Caos de los demonios al caos de los biólogos , Universidad de México, Revista de la UNAM, México, D.F. Abr. 1996, pp 3-7. 8.- Teissier F. Honorato C. El enfoque de sistemas y la ecología, Facultad de Sistemas, U.A. de Coahuila, México, 1994. pp. 1-7, Saltillo, Coah., México. http://www.clades.cl/revistas/1/rev1art1.htm Lección 40 La Evolución del Pensamiento Agroecológico Susanna B. Hecht - Universidad de California, Los Angeles El término agroecología ha llegado a significar muchas cosas. Definidas a groso modo, la agroecología a menudo incorpora ideas sobre un enfoque de la agricultura más ligado al medio ambiente y más sensible socialmente; centrada no sólo en la producción sino también en la sostenibilidad ecológica del sistema de producción. A esto podría llamarse el uso "normativo" o "prescriptivo" del término agroecología, porque implica un número de características sobre la sociedad y la producción que van mucho más allá de los límites del predio agrícola. En un sentido más restringido, la agroecología se refiere al estudio de fenómenos netamente ecológicos dentro del campo de cultivos, tales como relaciones predador/presa, o competencia de cultivo/maleza. Visión Ecológica En el corazón de la agroecología está la idea que un campo de cultivos es un ecosistema dentro del cual los procesos ecológicos que ocurren en otras formaciones vegetales, tales como ciclos de nutrientes, interacción depredador/presa, competencia, comensalía y cambios sucesionales, también se dan.

255

La agroecología se centra en las relaciones ecológicas en el campo y su propósito es iluminar la forma, la dinámica y las funciones de estas relaciones. En algunos trabajos sobre agroecología está implícita la idea que por medio del conocimiento de estos procesos y relaciones los sistemas agroecológicos pueden ser administrados mejor, con menores impactos negativos en el medio ambiente y la sociedad, más sostenidamente y con menor uso de insumos externos. Como resultados, un número de investigadores de las ciencias agrícolas y de áreas afines, han comenzado a considerar el predio agrícola como un tipo especial de ecosistema -un agroecosistema- y a formalizar el análisis del conjunto de procesos e interacciones que intervienen en un sistema de cultivos. El marco analítico subyacente le debe mucho a la teoría de sistemas y a los intentos teóricos y prácticos hechos para integrar los numerosos factores que afectan la agricultura (Spedding 1975, Gliessman 1982, Conway 1985, Chambers 1983, Ellen 1982, Altieri 1983, Lowrance et. al. 1984). La Perspectiva Social Los agroecosistemas tienen varios grados de resiliencia y de estabilidad, pero estos no están estrictamente determinados por factores de origen biótico o ambiental. Factores sociales, tales como el colapso en los precios del mercado o cambios en la tenencia de las tierras, pueden destruir los sistemas agrícolas tan decisivamente como una sequía, explosiones de plagas o la disminución de los nutrientes en el suelo. Por otra parte, las decisiones que asignan energía y recursos materiales pueden aumentar la resiliencia y recuperación de un ecosistema dañado. Aunque la administración humana de los ecosistemas con fines de producción agrícola a menudo ha alterado en forma dramática la estructura, la diversidad, los patrones de flujo de energía y de nutrientes, y los mecanismos de control de poblaciones bióticas en los predios agrícolas, estos procesos todavía funcionan y pueden ser explorados experimentalmente. La magnitud de las diferencias de la función ecológica entre un ecosistema natural y uno agrícola depende en gran medida de la intensidad y frecuencia de las perturbaciones naturales y humanas que se hacen sentir en el ecosistema. El resultado de la interacción entre características endógenas, tanto biológicas como ambientales en el predio agrícola y de factores exógenos tanto sociales como económicos, generan la estructura particular del agroecosistema. Por esta razón, a menudo es necesaria una perspectiva más amplia para explicar un sistema de producción que está en observación.

256

Un sistema agrícola difiere en varios aspectos fundamentales de un sistema ecológico "natural" tanto en su estructura como en su función. Los agroecosistemas son ecosistemas semi-domesticados que se ubican en un gradiente entre una serie de ecosistemas que han sufrido un mínimo de impacto humano, como es el caso de las ciudades. Odum (1984) describe 4 características principales de los agroecosistemas: 1. Los agroecosistemas requieren fuentes auxiliares de energía, que pueden ser humana, animal y a combustible para aumentar la productividad de organismos específicos. 2. La diversidad puede ser muy reducida en comparación con la de otros ecosistemas. 3. Los animales y plantas que dominan son seleccionados artificialmente y no por selección natural. 4. Los controles del sistema son, en su mayoría, externos y no internos ya que se ejercen por medio de retroalimentación del subsistema. El modelo de Odum se basa principalmente en la agricultura modernizada del tipo que se encuentra en los Estados Unidos. Hay, sin embargo, muchos tipos de sistemas agrícolas, especialmente en los trópicos, que no corresponden a esta definición. Son especialmente sospechosas la cuestión de diversidad y la naturaleza de la selección utilizada en agriculturas complejas donde un sinnúmero de plantas y animales semi-domesticados y silvestres figura n en el sistema de producción. Conklin (1956), por ejemplo, describió agroecosistemas tradicionales en Filipinas que incluían más de 600 especies de plantas que eran cultivadas y manejadas. Aunque esta agricultura no era tan diversa como la de algunos bosques tropicales, era definitivamente más multiforme que muchos otros ecosistemas locales. Los sistemas agrícolas son una interacción compleja entre procesos sociales externos e internos, y entre procesos biológicos y ambientales. Estos pueden entenderse espacialmente a nivel de terreno agrícola, pero a menudo también incluyen una dimensión temporal. El grado de control externo versus control interno puede reflejar intensidad de administración a lo largo del tiempo, el que puede ser mucho más variable que el supuesto de Odum. En sistemas de roza, tumba y quema, por ejemplo, los controles externos tienden a disminuir en los períodos posteriores de barbecho.El modelo de agroecosistema de Odum marca un punto de partida interesante para la comprensión de la agricultura desde una perspectiva de los sistemas ecológicos, pero no puede abarcar la diversidad y complejidad de muchos agroecosistemas que se desarrollaron en las sociedades no occidentales, especialmente en los trópicos húmedos. Más aún, la falta de atención que el modelo pone en las determinantes

257

sociales de la agricultura tiene como resultado un modelo con un poder explicativo limitado. Los sistemas agrícolas son artefactos humanos y las determinantes de la agricultura no terminan en los límites de los campos. Las estrategias agrícolas no sólo responden a presiones del medio ambiente, presiones bióticas y del proceso de cultivo, sino que también reflejan estrategias humanas de subsistencia y condiciones económicas (Ellen 1982). Factores tales como disponibilidad de mano de obra, acceso y condiciones de los créditos, subsidios, riesgos percibidos, información sobre precios, obligaciones de parentesco, el tamaño de la familia y el acceso a otro t6ipo de sustento, son a menudo críticas para la comprensión de la lógica de un sistema de agricultura. En especial cuando se analizan las situaciones de los pequeños campesinos fuera de los Estados Unidos y Europa, el análisis de la simple maximización de las cosechas en sistemas de monocultivo se hace menos útil para la comprensión del comportamiento del campesino y de sus opciones agronómicas (Scott 1978 y 1986, Barlett 1984, Chambers 1983). El Desafío Agroecológico Los científicos agrícolas convencionales han estado preocupados principalmente con el efecto de las prácticas de uso de la tierra y de manejo de los animales o la vegetación en la productividad de un cultivo dado, usando una perspectiva que enfatiza un problema objetivo, como es el de los nutrientes del suelo o los brotes de plagas.Esta forma de enfocar sistemas agrícolas ha sido determinada en parte por un diálogo limitado entre diferentes disciplinas, por la estructura de la investigación científica, la que tiende a atomizar problemas de investigación, y por un enfoque de la agricultura orientado a lograr un producto. No cabe duda que la investigación agrícola basada en este enfoque ha tenido éxito e incrementar el rendimiento en situaciones agroecológicamente favorables. Sin embargo, es cada vez mayor el número de científicos que reconoce que este enfoque reduccionista limita las opciones agrícolas para las poblaciones rurales y en que el "enfoque objetivo" a menudo involucra consecuencias secundarias no intencionadas que frecuentemente han producido daños ecológicos y han tenido altos costos sociales. La investigación agroecológica se concentra en asuntos puntuales del área de la agricultura, pero dentro de un contexto más amplio que incluye variables ecológicas y sociales. En muchos casos, las premisas sobre el propósito de un sistema agrícola difieren del enfoque que enfatiza la maximización del rendimiento y la producción, expuesto por la mayoría de los científicos agrícolas.

258

Como mejor puede describirse la agroecología es como un enfoque que integra ideas y métodos de varios sub-campos, más que como una disciplina específica. La agroecología puede ser un desafío normativo a las maneras en que varias disciplinas enfocan los problemas agrícolas. Tiene sus raíces en las ciencias agrícolas, en el movimiento del medio ambiente, en la ecología (en particular en la explosión de investigaciones sobre los ecosistemas tropicales), en el análisis de agroecosistemas indígenas y en los estudios sobre el desarrollo rural.Cada una de estas áreas de investigación tiene objetivos y metodologías muy diferentes, sin embargo, tomadas en un conjunto todas han sido influencias legítimas e importantes en el pensamiento agroecológico. Influencias de pensamiento agroecológico Ciencias Agrícolas Como Altieri (1987) lo ha señalado, el crédito de gran parte del desarrollo inicial de la agricultura ecológica en las ciencias formales le pertenece a Klages (1928), quien sugirió que se tomaran en cuenta los factores fisiológicos y agronómicos que influían en la distribución y adaptación de especies específicas de cultivos, para comprender la compleja relación existente entre una planta de cultivo y su medio ambiente. Más adelante, Klages (1942) expandió su definición e incluyó en ella factores históricos, tecnológicos y socioeconómicos que determinaban qué cultivos podían producirse en una región dada y en qué cantidad. Papadakis (1938) recalcó que el manejo de cultivos debería basarse en la respuesta del cultivo al medio ambiente. La ecología agrícola fue aún más desarrollada en los años 60 por Tischler (1965) e integrada al curriculum de la agronomía en cursos orientados al desarrollo de una base ecológica a la adaptación ambiental de los cultivos. La agronomía y la ecología de cultivos están convergiendo cada vez más, pero la red entre la agronomía y las otras ciencias (incluyendo las ciencias sociales) necesarias para el trabajo agroeocológico, están recién emergiendo. Las obras de Azzi (1956), Wilsie (1962), Tischler (1965), Chang (1968) y Loucks (1977) representan un cambio de enfoque gradual hacia un enfoque ecosistémico de la agricultura. En particular fue Azzi (1956) quien acentuó que mientras la meteorología, la ciencia del suelo y la entomología son disciplinas diferentes, su estudio en relación con la respuesta potencial de plantas de cultivo converge en una ciencia agroecológica que debería iluminar la relación entre las plantas cultivadas y su medio ambiente. Wilsie (1962),analizó los principios de adaptación de cultivos y su distribución en relación a factores del hábitat, e hizo un intento para formalizar el cuerpo de

259

relaciones implícitas en sistemas de cultivos. Chang (1968) prosiguió con la línea propuesta por Wilsie, pero se centró en un grado aún mayor en los aspectos ecofisiológicos. Desde comienzos de los años 70, ha habido una expansión enorme en la literatura agronómica con un enfoque agroecológico, incluyendo obras tales como las de Dalton (1975), Netting (1974) van Dyne (1969), Spedding (1975), Cox y Atkins (1979), Richards P. (1984), Vandermeer (1981), Edens y Koenig (1981), Edens y Haynes (1982), Altieri y Letourneau (1982), Gliessman et al. (1981), Conway (1985), Hart (1979), Lowrance et al. (1984) y Bayliss-Smith (1982). A fines de la década del 70 y a comienzos de la del 80 un componente social cada vez mayor comenzó a aparecer en la literatura agrícola, en gran parte como resultado del estudio sobre el desarrollo rural en los Estados Unidos (Buttel, 1980). La contextualización social unida al análisis agronómico ha generado evaluaciones complejas de la agricultura, especialmente en el caso del desarrollo regional (Altieri y Anderson 1986, Brush 1977, Richards P. 1984 y 1986, Kurin 1983, Bartlett 1984, Hecht 1985, Blaikie 1984). Los entomólogos en sus intentos de desarrollar sistemas de manejo integrado de plagas, han hecho contribuciones valiosas al desarrollo de una perspectiva ecológica para la protección de las plantas. La teoría y la práctica del control biológico de plagas se basa exclusivamente en principios ecológicos (Huffaker y Messenger 1976). El manejo ecológico de plagas se centra en primer lugar en enfoques que contrastan la estructura y el funcionamiento de los sistemas agrícolas con aquellas de sistemas naturales relativamente no perturbados, o sistemas agrícolas más complejos (Southwood y Way 1970, Price y Waldbauer 1975, Levins y Wilson 1979, Risch 1981 y Risch et al. 1983). Browning y Frey (1969) han argumentado que los enfoques de manejo de plagas deberían hacer hincapié en el desarrollo de agroecosistemas que emularan la sucesión natural lo más posible, debido a que estos sistemas más maduros son a menudo más estables que los sistemas consistentes en una estructura sencilla de monocultivos. Enfoque Metodológico Una gran cantidad de métodos de análisis agroecológico se están desarrollando en la actualidad en todo el mundo. Se podría considerar que se utilizan principalmente cuatro enfoques metodológicos:

260

1. Descripción Analítica. Se están realizando muchos estudios que miden y describen cuidadosamente los sistemas agrícolas y miden propiedades específicas tales como la diversidad de plantas, la acumulación de biomasa, la retención de nutrientes y el rendimiento. Por ejemplo, el Centro Internacional de Agroforestería (ICRAF) ha estado desarrollando una base internacional de datos de los diferentes tipos de sistemas de agroforestería y los está correlacionando con una variedad de parámetros medio ambientales para desarrollar modelos regionales de cultivos mixtos (Nair 1984, Huxley 1983). Este tipo de información es valiosa para ampliar nuestra comprensión de los tipos de sistemas existentes, de los componentes que habitualmente se encuentran ensamblados y en qué contexto ambiental. Este es el primer paso necesario. Los estudios representativos de este tipo de pensamiento son numerosos e incluyen a Ewel 1986, Alcorn 1984, Marten 1986, Denevent et al. 1984 y Posey 1985. El análisis Comparativo. La investigación comparativa generalmente involucra la comparación de un monocultivo u otro sistema de cultivo con un agroecosistema tradicional de mayor complejidad. Los estudios comparativos de este tipo involucran un análisis de la productividad de cultivos específicos, de la dinámica de las plagas o del estatus de los nutrientes en cuanto están relacionados con factores tales como la diversidad de los campos de cultivo, la frecuencia de las malezas, la población de insectos y los patrones de reciclaje de nutrientes. Varios estudios de este tipo se han llevado a cabo en América Latina, Africa y Asia (Uhl y Murphy 1981, Marten 1986 y Woodmansee 1984). Dichos proyectos usan metodologías científicas de tipo estándar para iluminar la dinámica de sistemas locales de cultivos mixtos específicos, comparándolos con los monocultivos. Estos datos a menudo son útiles pero la heterogeneidad de los sistemas locales puede oscurecer la comprensión de cómo éstos funcionan. Comparación Experimental. Para establecer la dinámica y para reducir el número de variables, muchos investigadores desarrollan una versión simplificada del sistema nativo en el cual las variables pueden ser controladas más de cerca. Por ejemplo, el rendimiento de un cultivo mixto de maíz, poroto y calabaza puede ser comparado al del cultivo simple de cada una de estas especies. Sistemas Agrícolas Normativos.

261

Estos se construyen a menudo con modelos teóricos específicos en mente. Un ecosistema natural puede ser ilimitado, o un sistema agrícola nativo podría ser reconstituido con mucho esfuerzo. Este enfoque está siendo evaluado en forma experimental por varios investigadores en Costa rica. Ellos están desarrollando sistemas de cultivos que emulan las secuencias sucesionales por medio del uso de cultivos que son botánica y morfológicamente semejante a las plantas que naturalmente ocurren en varias etapas sucesionales (Hart 1979, Ewel 1986). Aún cuando la agronomía ha sido sin lugar a dudas la disciplina materna de la agroecología, ésta recibió una fuerte influencia del surgimiento del ambientalismo y de la expansión de los estudios ecológicos. El estudio del medio ambiente fue necesario para proporcionar el marco filosófico en el cual el valor de las tecnologías alternativas y el proyecto normativo de la agroecología pudieran apoyarse. Los estudios ecológicos fueron críticos en la expansión de los paradigmas por medio de los cuales cuestiones agrícolas pudieran desarrollarse, y de las destrezas técnicas para analizarlos. Ambientalismo Importancia de este movimiento. El movimiento ambiental de los años 60 - 70 ha hecho una gran contribución intelectual a la agroecología. Debido a que los asuntos del ambientalismo coincidían con la agroecología, ellos infundieron al discurso agroecológico una actitud crítica de la agronomía orientada hacia la producción, e hicieron crecer la sensibilidad hacia un gran número de asuntos relacionados con los recursos. La versión de los años 60 del movimiento ambiental se originó como consecuencia de una preocupación con los problemas de contaminación. Estos eran analizados en función tanto de los fracasos tecnológicos como de las presiones de la población. La perspectiva Maltusiana ganó una fuerza especial a mediados de la década del 60 por medio de obras tales como "La Bomba Poblacional" de Paul Ehrlich (1966) y "La Tragedia de los Comunes" de Garret Hardin (1968). Estos autores dieron como principal causa de la degradación ambiental y del agotamiento de recursos al crecimiento de la población. Este punto de vista fue técnicamente ampliado por la publicación de "Los Límites del Crecimiento" del Club de Roma, el que utilizó simulaciones computarizadas de las tendencias globales dela población, del uso de recursos y la contaminación, para generar argumentos para el futuro, los que generalmente eran desastrosos.

262

Esta posición ha sido criticada desde epistemológicas (Simon y Kahn 1985).

perspectivas

metodológicas

y

Mientras que "Los Límites del Crecimiento" desarrolló un modelo generalizado de la "crisis ambiental", dos volúmenes seminales posteriores contenían una relación especial al pensamiento agroecológico, porque en ellos se perfilaban visiones de una sociedad alternativa. Estos fueron "Ante-proyecto de la Supervivencia" (El ecologista, 1972) y "Lo Pequeño es Hermoso" (Schumacher, 1973). Estos trabajos incorporaban ideas sobre la organización social, la estructura económica y valores culturales y las convertían en una visión exhaustiva más o menos utópica. "Ante-proyecto de la Supervivencia" argumentaba a favor de la descentralización de empresas de pequeña envergadura y acentuaba las actividades humanas que involucrarían un mínimo de disrupción ecológica y un máximo de conservación de energía y materiales. El santo y seña era autosuficiencia y sustentabilidad. El libro de Schumacher acentuaba una evaluación radical de la racionalidad económica ("Economía Budista"), un modelo descentralizado de la sociedad humana ("dos millones de aldeas") y una tecnología apropiada. El significado especial de "Lo Pequeño es Hermoso" era que estas ideas se ampliaron para alcanzar el Tercer Mundo. Problemas Agrícolas. Los asuntos ambientales en su relación con la agricultura fueron claramente señalados por Carson en su libro "Primavera Silenciosa" (1964), el que planteaba interrogantes sobre los impactos secundarios de las substancias tóxicas, especialmente de los insecticidas, en el ambiente. Parte de la respuesta a estos problemas fue el desarrollo de enfoques de manejo de plagas para la protección de los cultivos, basados enteramente en su teoría y práctica en los principios ecológicos (Huffaker y Messenger 1976). El impacto tóxico de los productos agro-químicos era sólo una de las interrogantes ambientales, debido a que el uso excesivo de los recursos energéticos también se estaba convirtiendo en un asunto cada vez más importante. Era necesario evaluar los costos energéticos de sistemas de producción específicos: especialmente a comienzos de la década del 70 cuando los precios del petróleo se fueron a las nubes. El clásico de Pimentel y Pimentel (1979) demostró que en la agricultura americana cada kilo-caloría derivado del maíz se "obtenía" a un enorme costo energético de energía externa. Los sistemas de producción norteamericanos fueron por lo tanto comparados con otros varios tipos de agricultura, los que eran de menor producción por área de unidad (en términos de kilo-calorías por cada hectárea) pero mucho más eficientes en términos de rendimiento por unidad de energía invertida.

263

El alto rendimiento de la agricultura moderna se obtiene a costa de numerosos gastos, los que incluyen insumos no renovables tales como el combustible de fósiles. En el Tercer Mundo esta energía a menudo es importante, y cargada a la balanza internacional de pagos, empeorando la situación de endeudamiento de muchos países en desarrollo. Más aún, debido a que la mayor parte de la energía no se utiliza para el cultivo de alimentos, la ganancia en la producción no se traduce necesariamente en un mejor abastecimiento de alimentos (Crouch y de Janvry 1980, Graham 1984 y Dewey 1981). Finalmente, las consecuencias sociales de este modelo tienen impactos complejos y a menudo extremadamente negativos en la población local, en especial en aquellos que tienen un acceso limitado a tierras y a créditos. Estos problemas se discuten en detalle más adelante en este capítulo. Los problemas de la toxicidad y recursos de la agricultura ensamblaron con los problemas mayores de la transferencia tecnológica en contextos del Tercer Mundo. "La Tecnología Descuidada" (editada por Milton y Farvar en 1968) fue una de las primeras publicaciones que intentó, en gran medida, documentar los efectos de proyectos de desarrollo y transferencia de tecnologías de zonas templadas, sobre las ecologías y las sociedades de los países en desarrollo. Cada vez en mayor número, investigadores de diferentes áreas comenzaron a hacer comentarios sobre la pobre "adecuación" entre los enfoques que se dan al uso de la tierra en el Primer Mundo y la realidad del Tercer Mundo. El artículo de Janzen (1973), sobre agroecosistemas tropicales, fue la primera evaluación ampliamente difundida de por qué los sistemas agrícolas tropicales podrían comportarse de una forma diferentes a los de las zonas templadas. Este trabajo y el de Levins (1973) plantearon un desafío a los investigadores agrícolas, que los llevó a repensar la ecología de la agricultura tropical. Al mismo tiempo, el problema filosófico más amplio planteado por el movimiento ambiental tuvo resonancia en la re-evaluación de las metas del desarrollo agrícola en los Estados Unidos y en el Tercer Mundo, y en las bases tecnológicas sobre las que serían llevadas a cabo. En el mundo desarrollado estas ideas sólo tuvieron un impacto moderado en la estructura de la agricultura, porque la confiabilidad y disponibilidad de productos agroquímicos y energéticos aplicados a la agricultura tenía como resultado transformaciones pequeñas en el patrón de uso de recursos en la agricultura.

264

En situaciones en las que tanto los campesinos como la nación estaban presionando por los recursos, donde prevalecían estructuras distributivas regresivas y donde el enfoque de las zonas templadas no era apropiado a las condiciones ambientales locales, el enfoque agroecológico parecía de especial relevancia. La integración de la agronomía y el ambientalismo ensambló con la agroecología, pero los fundamentos intelectuales para una asociación académica de este tipo eran aún relativamente débiles. Era necesario un enfoque teórico y técnico más claro, especialmente en relación con los sistemas tropicales. El desarrollo de la teoría ecológica tendría una relevancia especial en el desarrollo del pensamiento agroecológico. Ecología Por varias razones los ecológos han tenido una importancia singular en la evolución del pensamiento agroecológico. En primer lugar, el marco conceptual de la agroecología y su lenguaje son esencialmente ecológicos. En segundo lugar, los sistemas agrícolas son en sí mismos interesantes sujetos de investigación, en los cuales los investigadores tienen mucho mayor habilidad para controlar, probar y manipular los componentes del sistema, en comparación con los ecosistemas rurales. Estos pueden proporcionar condiciones de pruebas para un patrón amplio de hipótesis ecológicas, y de hecho ya han contribuido substancialmente al cuerpo de conocimiento ecológico (Levins 1973, Risch et al. 1983, Altieri 1987, Uhl et al. 1987). En tercer lugar, la explosión de investigaciones sobre los sistemas tropicales ha dirigido la atención al impacto ecológico de la expansión de sistemas de monocultivos en zonas que se caracterizan por su diversidad y extraordinaria complejidad (Janzen 1973, Uhl 1983, Uhl y Jordan 1984, Hecht 1985). En cuarto lugar, varios ecólogos han comenzado a dirigir su atención a las dinámicas ecológicas de los sistemas agrícolas tradicionales (Gliessmann 1982, Altieri y Farrell 1984, Anderson et al. 1987, Marten 1986, Richards 1984 y 1986). Tres áreas de interés académico han sido especialmente críticas en el desarrollo de los análisis agroecológicos: el ciclaje de nutrientes, las interacciones de plagas/plantas y la sucesión ecológica. A modo de ilustración esta sección se concentrará en el ciclaje de nutrientes.

265

A comienzos de los años 60 el análisis del ciclaje de nutrientes en los sistemas tropicales se convirtió en un tópico de interés y fue considerado como un proceso vital del ecosistema. Varios estudios, tales como el estudio de Puerto Rico de Odum (1976), la investigación de Nye y Greenland en 1961 y más adelante la serie de artículos y monografías que derivaron de trabajos realizados en San Carlos, Venezuela, Catci, Costa Rica y otros lugares en Asia y Africa han sido la simiente que clarifica los mecanismos de los ciclajes de nutrientes, tanto en bosques nativos como en áreas que han sido cultivadas (Jordan 1985, Uhl y Jordan 1984, Buschbacker et al. 1987, Uhl et al. 1987). Los hallazgos ecológicos de esta investigación sobre el ciclaje de nutrientes y que tuvieron un mayor impacto en el análisis de la agricultura fueron: • La relación entre la diversidad y las estrategias inter-especies para captar nutrientes. • La importancia de los rasgos estructurales para aumentar la captación de nutrientes tanto abajo como encima del suelo. • La dinámica de los mecanismos fisiológicos en la retención de nutrientes. • La importancia de relaciones asociativas de plantas con micro-organismos tales como micorrizas y fijadores simbióticos de nitrógeno. • La importancia de la biomasa como el lugar de almacenaje de los nutrientes.

Estos hallazgos sugerían que los modelos ecológicos de la agricultura tropical incluirían una diversidad de especies (o al menos de cultivos) para aprovechar la variedad de absorción de nutrientes, tanto en términos de diferentes nutrientes como en la absorción de nutrientes de los diferentes niveles de profundidad del suelo. La información producida por los estudios ecológicos sobre el ciclaje de nutrientes también sugería el uso de plantas tales como las leguminosas que con facilidad forman asociaciones simbióticas, y el uso más extendido de plantas perennes en el sistema de producción, como un medio para bombear nutrientes de las diferentes capas del suelo y aumentar así la capacidad total de reciclaje y almacenamiento de nutrientes en el ecosistema.

266

No es sorprendente hallar que muchos de estos principios ya estaban siendo aplicados en numerosos sistemas agrícolas desarrollados por poblaciones locales en los trópicos. La mayor parte de la literatura ecológica, la comparación entre ecosistemas naturales y agroecosistemas se han basado en agroecosistemas desarrollados por ecologistas posteriormente a cierta observación de un ecosistema local más bien que después de observar sistemas locales verdaderamente desarrollados. Más aún, la investigación se centró en parámetros tales como la diversidad de semillas, acumulación de biomasa y almacenaje de nutrientes en sucesión. Esta investigación nos ha proporcionado cierta comprensión de algunas dinámicas de los sistemas agrícolas considerados como entidades biológicas, pero hasta qué punto el manejo (con excepción del llevado a cabo por algunos alumnos relativamente inexpertos) influye en estos procesos sigue siendo un área casi enteramente inexplorada (un caso excepcionalmente sobresaliente en este aspecto es el Uhl et al. 1987). Las limitaciones del enfoque puramente ecológico están siendo cada vez más superadas a medida que los investigadores comienzan a analizar los sistemas campesinos y nativos en equipos multi-disciplinarios y desde un perspectiva más holística (Anderson y Anderson 1983, Hecht et al. 1987, Anderson et al. 1987, Marten 1986, Denevan et al. 1984). Estos esfuerzos tienen como intención el colocar a la agricultura en un contexto social: utilizan modelos nativos locales y explicaciones nativas del por qué se realizan ciertas actividades para el desarrollo de hipótesis que más adelante pueden ser probadas por medio de modelos agronómicos y científicos. Esta es un área de investigación floreciente con implicancias tanto teóricas como aplicadas de mucha importancia, y una gran inspiración para la teoría y práctica de la agroecología. Sistemas nativos de producción Otra influencia mayor en el pensamiento agroecológico es aquella que procede de los esfuerzos de investigación de los antropólogos y los geógrafos dedicados a describir y analizar las prácticas agrícolas y la lógica de los pueblos nativos y campesinos. Típicamente, estos estudios se han preocupado del uso de recursos y del manejo de toda la base de subsistencia, no solamente del predio agrícola, y se han concentrado en cómo los pueblos locales explican esta base de subsistencia, y en cómo los cambios sociales y económicos afectan los sistemas de producción.

267

El análisis científico del conocimiento local han sido un fuerza importante para reevaluar los supuestos de los modelos coloniales y agrícolas de desarrollo. La obra pionera en este campo fue la de Audrey Richards (1939) sobre las prácticas de roza, tumba y quema (sistema citamene) en el Africa Bemba. El sistema citamene involucra el uso de desechos de árboles como compost en las prácticas agrícolas de los terrenos montañosos en Africa Central. Este estudio, que acentúa los resultados de las tecnologías agrícolas y de las explicaciones ecológicas de los pueblos nativos, contrasta diametralmente con aquella percepción despreciativa de la agricultura nativa que considera las prácticas locales como desordenadas y de inferior calidad. Otra importante contribución al estudio de sistemas de cultivo nativos fue el trabajo de Conklin (1956), el que sentó las bases para la re-evaluación de la agricultura itinerante, basado en dados etnográficos y agronómicos sobre los Hnunoo de las Filipinas. Este trabajo señala la complejidad ecológica y diversidad de los patrones de agricultura itinerante y la importancia de los policultivos, la rotación de cultivos y sistemas de agroforestería, en el marco total de la producción itinerante. Es uno de los estudios más tempranos y más ampliamente conocidos sobre la estructura y complejidad del cultivo de roza, tumba y quema, e incorpora mucha intuición ecológica. Fue de especial importancia el énfasis que Conklin puso en el conocimiento ecológico nativo y la importancia que le asignó a explotar esta rica fuente de comprensión etnocientífica. Sin embargo, él hacía hincapié en que el acceso a esta información requería habilidades tanto etnoFigura s como científicas. Investigadores tales como Richards, P. 1984, Bremen y de Wit 1983, Watts 1983, Posey 1984, Denevan et al. 1984, Hecht y Posey 1987, Browkenshaw et al. 1979 y Conklin 1956, entre muchos otros, han estudiado los sistemas nativos de producción y sus categorías de conocimiento sobre las condiciones ambientales y prácticas agrícolas. Este cuerpo de investigación se centra en el punto de vista nativo de los sistemas de producción y los analiza con los métodos científicos occidentales. Todos estos autores han hecho hincapié en que la organización social y las relaciones sociales de la producción deberían considerarse tan de cerca como el medio ambiente y los cultivos. Este acento en la dimensión social de la producción es una base importante para la comprensión de la lógica de producción de sistemas agrícolas.

268

Otro resultado importante de gran parte del trabajo sobre los sistemas nativos de producción es la idea que se necesitan diferentes nociones de eficiencia y racionabilidad para comprender los sistemas nativos de campesinos. Por ejemplo, la eficiencia de producción por unidad de labor invertida, más bien que una simple relación de rendimiento por áreas es básica para la lógica de producción de muchos cultivadores del Tercer Mundo. Las prácticas que se centran en evitar riesgos, puede que no sean tan rendidoras a corto plazo, pero pueden ser preferibles a opciones de uso de tierras altamente productivas pero que tienen mayores riesgos. La disponibilidad de trabajo, en especial en épocas importantes como es la de las cosechas, puede también influir en los tipos de sistemas agrícolas favorecidos. Este tipo de investigación ha influido en el desarrollo de los argumentos contrarios a aquellos que atribuían el fracaso de la transferencia de tecnología agrícola a ignorancia e indolencia. Este enfoque, con el acento en los factores humanos de los sistemas agrícolas, también ponía más atención en las estrategias de los campesinos de diferentes estratos sociales, y cada vez más en el rol de la mujer en la agricultura y el manejo de recursos (Deere 1982, Moock 1986). El análisis etno-agrícola ha contribuido mucho a la expansión de las herramientas conceptuales y prácticas de la agroecología. El enfoque (marco étnico) basado en la explicación de una cultura dada ha sugerido relaciones que los marcos "étnicos" (es decir marcos externos, generalmente referidos a modelos occidentales de expansión) no capturan fácilmente, al basarse en los métodos de la ciencia occidental. Más aún, esta investigación ha explayado el concepto de lo que puede con provecho ser llamado agricultura, debido a que muchos grupos están involucrados en la manipulación de ecosistemas forestales a través del manejo de la sucesión y la reforestación actual (Posey 1985, Anderson et al. 1987, Alcorn 1984). Aún más, la agricultura desarrollada localmente incorpora numerosos cultivos cuyo germoplasma es esencial para el "desarrollo" de programas de mejoramiento genético como el de la yuca y porotos, y también incluye numerosas plantas con un potencial de uso más amplio en ambientes difíciles. Finalmente, dicho trabajo valora los logros científicos de cientos de años de cultivo de plantas y trabajo agronómico llevado a cabo por las poblaciones locales.

269

El estudio de sistemas agrícolas nativos ha proporcionado gran parte de la materia prima para el desarrollo de hipótesis y sistemas de producción alternativos para la agroecología. Cada vez es más amplio el estudio de la agricultura nativa realizado por equipos multi-disciplinarios para documentar las prácticas y se han desarrollado categorías de clasificación para analizar los procesos biológicos dentro de los sistemas agrícolas y para evaluar aspectos de las fuerzas sociales que influyen en la agricultura. El estudio de sistemas nativos ha sido seminal en el desarrollo del pensamiento agroecológico. Estudios del desarrollo El estudio del desarrollo rural del Tercer Mundo también ha sido una gran contribución a la evolución del pensamiento agroecológico. El análisis rural ha ayudado a clasificar la lógica de las estrategias locales de producción en comunidades que están sufriendo grandes transformaciones, a medida que las áreas rurales se integran a economías regionales, nacionales y globales. Los estudios sobre el desarrollo rural han documentado la relación que existe entre los factores socioeconómicos y la estructura y organización social de la agricultura. Existen varios temas de investigación sobre el desarrollo, que han sido de especial importancia para la agroecología, incluyendo el impacto de las tecnologías inducidas desde afuera, el cambio de cultivos, los efectos de la expansión de mercados, las implicancias de los cambios de relaciones sociales y la transformación en las estructuras de tenencia de tierras y de acceso a los recursos económicos. Todos estos procesos están íntimamente ligados. Cómo ellos afectan los agroecosistemas regionales es el resultado de complejos procesos históricos y políticos.La investigación de la Revolución Verde fue importante para la evolución del pensamiento agroecológico porque los estudios sobre el impacto de esta tecnología fueron un instrumento que arrojó luz sobre los tipos de prejuicios que predominaban en el pensamiento agrícola y de desarrollo.Esta investigación también tuvo como resultado el primer análisis verdaderamente interdisciplinario de cuestiones de tenencia de tierras y del cambio tecnológico en la agricultura desde un punto de vista ecológico, social y económico; todo esto realizado por un amplio espectro de analistas. La extraordinaria aceleración del proceso de estratificación social del campesino que se asocia a la Revolución Verde indicaba inmediatamente que ésta no era una tecnología neutra en sus objetivos y resultados, sino más bien que podría transformar dramáticamente la base de la vida rural de un gran número de personas.

270

Como lo hizo notar Perelman en 1977, los más beneficiados por dichas tecnologías fueron los consumidores urbanos. La estrategia de la Revolución Verde se desarrolló cuando los problemas de la pobreza y el hambre eran considerados principalmente como problemas de producción.Este diagnóstico implicó varias estrategias que se centraban en áreas agrícolas en las que rápidamente podrían llevarse a cabo aumentos de producción, suelos de mejor calidad y tierras de riego entre granjeros con bienes materiales y de capital substanciales. Tuvo éxito en términos de elevar la producción: en el fondo era parte de una política de apostar conscientemente al más fuerte (Chambers y Ghildyal 1985, Pearce 1980). Es ahora generalmente reconocido que solamente el aumento agregado de la producción de alimentos no soluciona el problema del hambre y la pobreza rural, aunque sí puede reducir los costos de alimentos para los sectores urbanos (Sen 1981, Watts 1983). Las consecuencias de la Revolución Verde en las áreas rurales fueron tales que sirvieron para marginalizar a gran parte de la población rural.En primer lugar, centró sus beneficios en los grupos que eran ricos en recursos, acelerando así la diferencia entre ellos y los otros habitantes rurales, por lo que la desigualdad rural a menudo aumentó.En segundo lugar, socavó muchas formas de acceso a la tierra y a los recursos, tales como los cultivos de mediería, el arriendo de mano de obra y el acceso a medios de riego y tierras de pastoreo. Esto redujo la diversidad de estrategias de subsistencia disponibles a las familias rurales y, por lo tanto, aumentó la dependencia del predio agrícola. El estrechamiento de la base genética de la agricultura aumentó los riesgos porque los cultivos se hicieron más vulnerables a plagas y enfermedades y a los caprichos del clima. En el caso de arrozales inundados o regados, la contaminación generada por el uso de pesticidas y herbicidas a menudo minó una importante fuente local de proteínas: el pescado. El análisis de la Revolución Verde hecho desde el punto de vista de diferentes disciplinas, contribuyó al primer análisis holístico de las estrategias de desarrollo agrícola/rurales. Fue la primera evaluación ampliamente difundida que incorporó críticas ecológicas, tecnológicas y sociales.Este tipo de enfoque y de análisis ha sido el prototipo de varios estudios posteriores sobre la agroecología, y el progenitor de la investigación sobre sistemas de labranza. Es hoy ampliamente reconocido que las tecnologías de la Revolución Verde pueden ser aplicadas en áreas limitadas y ha habido peticiones de varios analistas del desarrollo rural en el sentido de re-dirigir la investigación agrícola en la dirección de campesinos de bajos recursos.

271

En el mundo existen por lo menos un billón de campesinos de recursos, ingresos y flujos de producción muy limitados, quienes trabajan en un contexto agrícola de extrema marginalidad. Los enfoques que hacen hincapié en paquetes de tecnologías generalmente requieren de recursos a los cuales la mayoría de los campesinos del mundo no tienen acceso (Tabla 2). Muchos analistas del desarrollo rural reconocen hoy las limitaciones para la agricultura de los enfoques tipo Revolución Verde que enfatizan agricultura a gran escala, pero estos modelos agrícolas han dominado de una forma sorprendente los proyectos de desarrollo agrícola del Tercer Mundo.Mientras los resultados de las estaciones experimentales de investigación se veían extremadamente promisorios, el bajo grado de adopción por campesinos y de reproducción exacta de los modelos en los campos, ha ocasionado grandes dificultades en muchos proyectos. El enfoque de transferencia de tecnologías tendía a acelerar las diferencias, exacerbando muchas situaciones políticas difíciles o las tecnologías sólo eran parcialmente adoptadas y en muchos casos no adoptadas del todo (Scott 1978 y 1986).Varias eran las explicaciones para la baja transferencia de tecnologías, incluyendo la idea que los campesinos eran ignorantes y que era necesario enseñarles a cultivar. Otro set de explicaciones se centró en las exigencias a nivel de granja, tales como la falta de créditos que limitaban la posibilidad de los campesinos de adoptar estas tecnologías. En el primer caso se considera que la falla está en el campesino; en el segundo se culpa a problemas de infraestructura de diferentes tipos. Nunca se criticó a la tecnología misma.Varios investigadores de terreno y practicantes del desarrollo se han sentido frustrados por estas explicaciones y un número cada vez mayor han señalado que las tecnologías en si requieren de una reevaluación sustancial. Ellos han argumentado que la decisión del campesino de adoptar o no una tecnología es la verdadera prueba de su calidad. A menudo a este enfoque se le ha llamado "el campesino primero y último" o "el campesino vuele al campesino" o "la revolución agrícola nativa". Según dicen Rhoades y Booth (1982) "la filosofía básica en la que se apoya este modelo es que la investigación y el desarrollo agrícola deben comenzar y terminar en el campesino. La investigación agrícola aplicada no puede comenzar aisladamente en un centro de experimentación o con un comité de planificación que está lejos del contacto con la realidad campesina. En la práctica esto significa obtener información acerca del campesino y comprensión de la percepción que el campesino tiene del problema y la aceptación de la evaluación que el campesino hace de la solución propuesta". Este enfoque requiere una participación mucho mayor de parte del campesino en el diseño y la implementación de programas de desarrollo rural (Chambers 1984,

272

Richards P. 1984, Gow y Van Sant 1983, Midgley 1986). Una consecuencia de esta posición ha sido reconocer el gran conocimiento que el campesino tiene de la entomología, botánica, suelos y agronomía, los que pueden servir como puntos de partida para la investigación. En este caso también, la agroecología ha sido identificada como una valiosa herramienta analítica asimismo como un enfoque normativo para la investigación. La agroecología encaja bien con los asuntos tecnológicos que requieren prácticas agrícolas más sensibles al medio ambiente y a menudo encuentra congruencias del desarrollo tanto ambiental como participativo con perspectivas filosóficas. La diversidad de preocupaciones y de cuerpos de pensamientos que han influido en el desarrollo de la agroecología son verdaderamente amplios. Sin embargo, esta es la extensión de los asuntos que inciden en la agricultura. Es por esta razón que ahora vemos agroecólogos con un entrenamiento mucho más rico que el encontrado corrientemente entre los alumnos de ciencias agrarias centrados en una disciplina, como asimismo muchos más equipos multidisciplinarios trabajando en estos asuntos en el campo.Aunque es una disciplina en pañales, y hasta el momento ha planteado más problemas quesoluciones, la agroecología indudablemente ha ampliado el discurso agrícola. Tabla El contraste en condiciones físicas y socioeconómicas de campesinos ricos en recursos versus aquellos pobres en recursos (Modificada de Chambers y Ghildyal 1985) Campesinos pobres en recursos ondulada o laderas delgados, no fértiles serias dificultades

Estaciones experimentales

Campesinos ricos en recursos

Topografía

plana o terrazas

plana o terrazas

Suelos

profundos, pocas dificultades

profundos, pocas dificultades

rara, solucionable

ocasional

bastante común

irrelevantes

pocos y controlables

comunes

Deficiencas de nutrientes Riesgos (fuego, des- lizamientos, etc.) Irrigación

generalmente frecuentemente, en disponible, de fácil completo control control

rara, poco confiable

273

grande o mediana- mente adyacente

pequeña, irregular no adyacente

Tamaño de la Unidad

grande, adyacente

Enfermedades, plagas, maleza

controladas con agroquímicos, mano de obra

controladas con agroquímicos, mano de obra

control cultural

ilimitado confiable

alto, confiable

bajo, no confiable

Semillas

alta calidad

alta calidad

semillas propias

Créditos

ilimitados

buen acceso

poco acceso con escasez temporal

Trabajo

sin dificultad de obtener

mano de obra contratada

familia, escasez en temporadas críticas

Precios

irrelevantes

bajos

Altos

Prioridad para la producción de alimentos

irrelevante

baja

alta

Acceso a fertilizantes, semillas mejoradas

BIBLIOGRAFIA • Alcorn, J.B. 1984, Huastec Mayan Ethnobotany. Austin. Unv. Texas Press. • Altieri, M.A. and M.K. Anderson, 1986. An ecological basis for the development of alternative agricultural system for small farmers in the Third World. Amer. J. Alter. Agric. 1:30-38. • Altieri M.A. and J.G. Farrel 1984. Traditional Farming systems of south central

274

Chile, with special emphasis on agroforestry. Agrofor. Syst. 2:3-18. • Altieri, M.A. and D.K. Letourneau 1982. Vegetation management and biological control in agroecosystems. Crop Prot. 1:405-430. • Altieri, M.A. 1987. Agroecology: The scientific basis of alternativo agriculture. Westview Press Boulder. • Anderson, A. and S. Anderson. 1983. People and the Palm Forest. Washington. U.S. MAB Publ. • Anderson, A., A. Gely, J. Strudwick, G. Sobel and M. Pinto. 1987. Un sistema agroforestal na varzea do Estuario Amazónico. Acta Amazónica (in press). • Azzi, G. 1956. Agricultural Ecology. London-Constable. • Bartlett, K. 1984. Agricultural Choice and Change. New York: Academic Press. • Bayliss-Smith, T.P. 1982. The Ecology of Agricultural Systems. LondonCambridge Univ. Press. • Blaikie, P. 1984. The Political Economy of Soil Erosion. New York: Methuen. • Bremen, H. and C.T. de Witt. 1983 Rangeland productivity and exploitation in the Sahel. Science 221 (4618): 1341-1348. • Brokenshaw, D., D. Warren and O. Wener. 1979. Indigenous Knoeledge Systems in Development. Washington: Univ. Press of America. • Browning, J.A. and K.J. Frey. 1969. Multiline curltivars as a means of disease control. Annu. Rev. Phytopathol. 7;355-382. • Brush, S. 1977. Mountain, Field and Family, Philadelphia: Univ. Penn. • Buschbacker, R., C. Uhl, E. Serrao. 1987. Abandoned pastures in Amazonia. II. Nutrient stocks. In: Soil and Vegetation. J. Ecol. (in press). • Buttel, F.H. 1980. Agriculture, environment and social change: some emergent issues. In: The Rural Sociology of the Advanced Societies. F.H. Buttel and H. Newby, eds. New Yersey: Allenheld, Osmun and Co. Pp. 453-488. • Carson, R. 1964. The Silent Spring. New York: Fawcett. • Chambers, R. 1983. Rural Development: Putting the Last First. London: Longman.

275

• Chambers, R. and B.P. Ghildyal. 1985. Agricultural Research for resource-poor farmers: the farmer first and last. Agricultural Admi. 20:1-30. • Chang, J.H. 1968. Climate and Agriculture. Chicago: Aldine Pub. Co. • Conklin, H.C. 1956. Hananoo Agriculture. Rome: FAO • Conklin, H.C. 1972. Folk Classification, a Topically Arranged Bibliography. New Have. Yale Univ. Dep. Anth. • Conway, G.R. 1985. Agroecosystem analysis. Agri. Adm.20:1-30. • Cox, G.W. and M.D. Atkins, 1979. Agricultural Ecology. San Francisco: W.H. Freeman and Sons. • Crouch, L. and A. de Janvry. 1980. The class bias of agricultural growth. Food Policy 3-13. • Dalton, G.E. 1975. Study of Agricultural Systems. London: Applied Sciences. • Deere. C.D. 1982. Women and the sexual division of labor in Peru. Economic Development and Cultural Change. 30:795-811. • Denevan. W., J. Tracy, and J.B. Alcorn. 1984. Indigenous agroforestry in the Peruvian Amazon: Examples of Bora Indian swidden fallows. Interciencia 96:346357. • Dewey, K. 1981. Nutritional consequences of the transformation from subsistence to commercial agriculture. Hum. Ecol. 9(2): 151-187. • Edens, T.C. and D.L.Haynes. 1982. Closed System agriculture: resource contraints, management options and design alternatives. Ann. Rev. Phytopathol. 20:363-395. • Edens, T.C. and H.E. Koenig. 1981. Agroecosystem management in a resourcelimited world. BioScience 30:697-710. • Ehrlich, P. 1966. The Population Bom. New York. Ballantine. • Ellen, R. 1982. Environment, Subsistence and System. New York: Cambridge Univ. Press. • Ewell J.J. 1986. Designing agricultural ecosystems for the humid tropics. Ann. Rev. Ecol. And Systematics 17:245-271.

276 • Geertz, C. 1962. Agricultural Involution. Berkeley: Univ. Calif. Press. • Ginzburg, C. 1983. The Night Beetles: Withcraft and Agrarian Cults in the Sixteenth and Seventeenth Centuries. London: Routledge and Kegan Paul. • Gliessman, S.R. 1982. The agroecosystem: an integrative focus for the study of agriculture (un publ.man.). • Gliessman, S.R., E.R. García and A.M. Amador. 1981. The ecological basis for the application of traditional agricultural technology in the management of tropical agro-ecosystems. Agro-ecosystems 7:173-185. • Glover, N. And J. Beer. 1986. Nutrient cycling in two traditional central American agroforestry systems. Agrofor. Syst. 4:77-87. • Gow, D. and J. Van Sant. 1983. Beyond the rethoric of participation. World Development. 11(5):427-446. • Graham, D. 1984. Undermining Rural Development with Cheap Credit. Boulder: Westview Press. • Hardin, G. 1968. The tragedy of the commons. Science 162:1243-1248. • Hart, R.D. 1979. Agroecosistemas: conceptos básicos. Costa Rica: CATIE. • Hecht, S.B. 1985. Environment, development and politics: capital accumulation and the livestock sector in eastern Amazonia. World Development 13(6):663-684. • Hecht, S.B. and D. Posey, 1987. Preliminary analysis of Kayapo soil management. Human Ecol. (in press). • Hecht, S.B., A. Anderson and P. May. 1987. The subsidy from nature: palms, shifting cultivation and rural development. Human Organiz. (in press). • Huffaker, C.B. and P.S.Messenger. 1976. Theory and Practice of Biological control. New York: Academic Press. • Huxley, P.A. 1983. Plant Research and Agroforestry. Nairobi: ICRAF. • Irvine, D. 1987. Successional processes. In: Indigenous Land Management Among Native Amazonians. New York: New York Botanical Garden. • Janzen, D.H. 1973. Tropical agroecosystems. Science 182:1212-1219.

277 • Jordan, C. 1985. Nutrient Cycling in Tropical Forests. New York: John Wiley and Sons. • Klages, K.H.W. 1928. Crop ecology and ecological crop geography in the agronomic curriculum. J. An. Soc. Agron. 10:336-353. • Klages, K.H.W. 1942. Ecological Crop Geography. New York: Mac Millan. • Kuhn, T. 1979. The Relationship Between History and History of Science. In: Interpretive Social Science. R. Rabinow and W. Sullivan, eds. Berkeley: Univ. Calif. Press. • Kurin, R. 1983. Indigenous agronomics and agricultural development ion the Indus basin. Human Organiza. 42(4):283-294. • Levins, R. 1973. Fundamental and applied research in agriculture. Science 181:523-524. • Levins, R. and M. Wilson. 1979. Ecological theory and pest management. Ann. Rev. Entomol. 25:7-19. • Locuks, O.L. 1977. Emergence of research on agro-ecosystems. Ann. Rev. Eco.Sys. 8:173-192. • Lowrance, R., B.R. Skinner and G.S. House. 1984. Agricultural Ecosystems. New York: Wiley Interscience. • Marte, G.G. 1986. Traditional Agriculture in Southeast Asia: A Human Ecology Perspective. Boulder Westview Press. • Merchant, C. 1980. The Death of Nature. Berkeley: Univ. Calif. Press. • Midgeley, J. 1986. Community Participation, Social Development and the State. New York: Methuen. • Milton, J. And T. Farvar. 1968. The Careless Technology. St. Louis: Wash.Univ.Press. • Moock, J. 1986. Understanding Africa's Rural Households and Farming Systems. Boulder: Westview Press. • Nair, P.K.R. 1984. Soil Productivity Aspects of Agroforestry. Nairobi: ICRAF. • Netting, R.Mc. 1974. Cultural Ecology. California: Cummings. • Nye, P.H. and D.J. Greenland. 1961. The Soil under Shifting Cultivation. England: Comm.Agri.Bur.

278 • Odum, E. 1984. Roperties of agroecosystems. In: Agricultural Ecosystems. Lowrance et al. Eds. New York: Willew Intersci. • Palmer, R. and N. Parsons. 1977. The Roots of Rural poverty in Central and Southers Africa. Berkeley: Univ.Calif.Press. • Papadakis, J. 1938. Compendium of Crop Ecology. Buenos Aires, Argentina: Papadakis. • Perelman, M. 1977. Farming for Profit in a Hungry World. New Jersey: Allanheld, Osmun and Co.Pub.Inc. • Pimentel, D. and M. Pimentel, 1979. Food, Energy and Society. London: Edward Arnold. • Price. P.W. and G.P. Waldbauer. 1975. Ecological aspects of pest management. I: Introduction to Insect Pest Management. R.L. Metcalf and W.H. Luckman, eds. New York: Wiley-Interscience, pp. 37-73. • Rhoades, R. and R. Booth. 1982. Farmer back to farmer: a model for generating agricultural technology. Agri. Admin. 11(2):127-137. • Richards, A. 1939. Land Labor and Diet in Northern Rhodesia. London: Routledge and Kegan Paul. • Richards, P. 1984. Indigenous Agricultural Revolution. Boulder: Westview Press. • Richards, P. 1986. Coping with hunger: Hazard and Experiment in African Rice Farming. Boulder: Westview Press. • Risch, S.J. 1981. Insect herbivore abundance in tropical monocultures and polycultures: an experiment testo of two hypotheses. Ecology 62:1325-1340. • Risch, S.J., D. Andow and M.A. Altieri. 1983. Agroecosystem diversity and pest control: data, tentative conclusions and new research directions. Env. Entomol. 12:625-629 • Schumacher, R. 1973. Small is Beatiful. London: Abacus. • Scott, J. 1978. The Moral Economy of the Peasant. Madison: Univ. Wiscon. • Scott, J. 1986. Weapons of the Weak: Everyday Forms of Peasant Resistence. New Haven: Yale Press. • Sen, A. 1981. Poverty and Famines. New York: Oxford Press.

279

• Simon, J. And H. Kahn. 1985. The Resourceful Earth. New York: Oxford Press. • Southwood, T.R.E. and M.J. Way. 1970. Ecological background to pest management. In: Concepts of Pest Management. R.L. Rabb and F.E. Guthrie, eds. North Carolina: North Carolina State University, pp. 6-28. • Spedding, C.R.W. 1975. The Biology of Agricultural Systems. London: Academic Press. • Tischler, W. 1965. Agrookologie. Jene: Eustan Fisher. • Uhl, C. 1983. Nutrient uptake and nutrient-retention related characteristics of common successional species in the ypper Rio Negro region of the Amazon basin. (unpublished man). • Uhl, C. and P. Murphy. 1981. A comparison of productivities and energy values between slash and burn agriculture and secondary succession in the upper Rio Negro region of the Amazon basin. Agroecosystems 7:63-83. • Uhl, C. and C. Jordan. 1984. Vegetation and nutrient dynamics during the first five years of succession following forest cutting and burning in the Rio Negro region of Amazonia. Ecology 65:1476-1490. • Uhl, C., R. Buschbacker and A. Serrao. 1987. Abandoned pastures in Amazonia. I. Patterns of plant succession. J.Ecol. (in press). • Van Dyne, G.M. 1969. The Ecosystem Concept in Natural Resource Management. New York: Academic Press. • Vandermeer, J. 1981. The interference production principle: an ecological theory for agriculture. BioScience 31:361-364. • Wasserstrom, R. 1982. Land and Labor in Chiapas. Berkeley: Univ. California Press. • Watts, M. 1983. Silent Violence. Berkeley: Univ. Calif. Press. • Wilsie, C.P. 1962. Crop Adaptation and Distribution. San Francisco: W.H. Freeman Co. • Wolf, E. 1982. Europe and the People Without History. Berkeley; Univ. California Press.

280

Lección 41 Teorías evolucionistas El concepto sobre el origen de la vida se ha expresado históricamente desde dos grandes corrientes: la evolutiva o de transformación de los seres vivos, controvertida por el fijismo, corriente que sostenía que los seres vivos habían sido creados de forma definitiva y acabada y no presentaban cambios. Algunos de los defensores del fijismo fueron: Carl Von Linneo quien planteó que las especies habían sido creadas de manera separada e independiente; y George Cuvier quien propuso la Teoría creacionista, que decía, que los seres vivos eran inalterables e inmutables desde su creación y que debido a constantes catástrofes naturales, como son los diluvios, terremotos, sequías algunas especies desaparecían y otras supervivían. Las teorías Evolucionistas explican el origen de las especies. Lección 42 Teoría Lamarkista La primera teoría que explica la evolución es la Lamarkista propuesta por Jean Baptiste de Lamark basada en el desarrollo espontáneo y en la herencia de los caracteres adquiridos Lamark sostenía que al producirse cambios en el medio ambiente los seres vivos debían generar modificaciones (desarrollo, atrofia, o desaparición) de sus órganos para lograr adaptarse y sobrevivir y estas modificaciones luego eran heredadas por sus descendientes. Por ejemplo, el alargamiento del cuello de las jirafas era un carácter adquirido que se explicaba por los persistentes esfuerzos adaptativos de las jirafas para alcanzar las hojas de los árboles. Lección 43 Teoría Darwinista Propuesta por Charles Darwin, explica el origen de las especies por medio de la selección natural, la variabilidad y la supervivencia del más apto. Darwin Planteó que: • Las especies cambian continuamente, con el tiempo unas se extinguen y aparecen otras nuevas. Darwin observó que las especies experimentan de manera espontánea, cambios estructurales a lo largo de generaciones suscesivas • Los cambios se producen gradual y continuamente.

281 • Los organismos descienden de un antepasado único, es decir, que los organismos semejantes están emparentados. • La evolución es resultado de un proceso de selección natural. En una primera fase de la evolución se produce variabilidad en cada generación y en una fase posterior se produce selección natural o lucha por la supervivencia, donde los más aptos sobreviven y los más débiles desaparecen. • Los más aptos sobrevivirán y transmitirán a su descendencia las características de fortaleza. La teoría de Darwin y su plantamiento sobre la supervivencia de los más aptos dió origen al funcionalismo que afirma que las características de los organismos vivos desarrollan funciones útiles.Darwin observó que si los cambios producen efectos favorables que permiten a los individuos reproducirse con mayor éxito, estos cambios eran herdados por sus descendientes quienes a su vez pueden producir más descendencia. http://www.natureduca.com/bio_teorias_evol.htm Darwin afirma en su obra El origen de las especies que el hombre de hecho no produce variabilidad; lo único que hace es exponer intencionadamente seres orgánicos a nuevas condiciones de vida, y luego la Naturaleza actúa sobre la organización, y causa la variabilidad. Pero el hombre puede seleccionar y selecciona las variaciones que la Naturaleza le da, y de este modo las acumula de cualquier modo que desee. Adapta así animales y plantas a su propio beneficio o placer. Puede hacerlo metódicamente o puede hacerlo inconscientemente, preservando los individuos que le son más útiles de momento, sin pensar en alterar la raza. No hay motivo aparente para que los principios que han actuado con tanta eficacia en la domesticación no hayan actuado en la Naturaleza. Nacen más individuos de los que pueden sobrevivir. La ventaja más ligera en un ser, de cualquier edad o en cualquier estación, sobre los demás seres con los cuales entra en competición, o una adaptación mejor, por mínima que sea, a las condiciones físicas que le rodean, cambiará el equilibrio en su favor. En resumen, Darwin afirmaba que la evolución es un proceso de selección natural en la cual, en una primera etapa se produce la mutación, recombinación y acontecimientos al azar (producción de la variabilidad genética), para en una segunda etapa quedar regulada esa variabilidad mediante la selección natural, y en la cual la selección artificial generada por el hombre no produce variabilidad.

282

Lección 44 Teoría Neodarwinista La Teoría Neodarwinista o Teoría Sintética de la evolución tiene su origen en la interpretación de la teoría Darwinista fundamentada en la genética. Esta teoría Esta teoría se ha construido paulatinamente por científicos tales como G. G. Simpson, Dobzhanski, Ernst Mayr, Thomas Henry Huxley, Dobzhansky, Alvaro Abeliuk Fischer, Sewall Wright, y otros. Según esta teoría los fenómenos evolutivos se explican básicamente por medio de las mutaciones y la producción de nuevas especies por reproducción sexual, mecanismos que darían origen a las variaciones, preservadas luego por acción de la selección natural de los portadores de dotación genética más favorable para hacer frente a las presiones ecológicas; estos portadores tienen una probabilidad de supervivencia y de procreación más alta que el resto de la población. Lección 45. Evolución del hombre Chiquitos pero muy hábiles Los australopitécidos de hace tres y cuatro millones de años eran bastante pequeños cuando llegaban a adultos. Medían no mas de 1.20 m y no pesaban más de 40 kilos. Su cerebro era también pequeño, alrededor de 400 cm3 (la manera como se mide la capacidad del cráneo es calculando el volumen; esto puede hacerse bastante fácilmente con cráneos fósiles). Es decir, un australopitécido tenía alrededor de 10 cm3 de cerebro por kilogramo de peso. Hace alrededor de 25 años se encontró en la barranca de Olduvai, en África Oriental un cráneo fosilizado de hace aproximadamente 1 750 000 años. Perteneció a un homínido que caminaba erguido y que tenía un cerebro de 800 cm3 para sus ¡40 kilos de peso! Esto significa que comparado con los australopitécidos este homínido tenía dos veces más de capacidad craneana (el hombre actual tiene un cerebro bastante mayor, de aproximadamente 1 350 cm3, que para los 60-70 kilos de peso promedio es también el doble que el de los australopitécidos). Posteriormente, en 1972 se descubrieron otros restos de estos homínidos en el lago Turkana, África, y se comprobó en forma definitiva que el tamaño del cerebro constituía la mayor diferencia con los australopitécidos. Además de restos de huesos, en esos lugares también se han encontrado pedazos de las herramientas que construyeron estos homínidos, que, aunque de tamaño pequeño, demuestran que tenían un cerebro relativamente grande. Es por esto que se les ha llamado Homo habilis, siendo, además, de los primeros homínidos que aparecieron en el

283

registro fósil a los que ya se les puede llamar hombres. Estos aparecieron hace dos millones de años. Cuando los arqueólogos buscan restos del pasado encuentran, además de huesos, muchas otras cosas que les hablan de la organización social y los hábitos de los homínidos que vivieron entonces. En el lago Turkana, en África, se ha descubierto uno de los sitios más interesantes en este aspecto. Del cuidadoso análisis de la basura dejada en un campamento usado por Homo habilis se ha podido entender el tipo de alimentación y la utilidad que las diferentes herramientas tenían para aquéllos. A partir de esta información se ha podido saber que sus actividades incluían la recolección de frutos y la caza. El hombre entonces cazaba en grupos y muy probablemente distribuía la comida que, unos cazando y otros recolectando, diferentes miembros de la comunidad obtenían. Así pues, la vida en comunidades donde se repartían las actividades ya existía hace dos millones de años. El homo erectus Entre hace dos millones de años y un millón de años nuestro registro de homínidos vuelve a ser pobre. De no encontrar australopitécidos se ha concluido que se extinguieron en ese periodo de tiempo. Los únicos homínidos que quedaron desde entonces pertenecen al género Homo. A su vez, el Homo habilis también desaparece del registro fósil, pero de hace un millón de años se han descubierto una gran cantidad de fósiles que pertenecían a homínidos que usaban herramientas (por lo que se les considera del género Homo), además de que ya conocían el fuego, puesto que en las cuevas que se han excavado hay restos calcinados y quemados de huesos, piedras y pedazos de madera. El descubrimiento de los primeros restos de estos homínidos, que son llamados Homo erectus en la actualidad, lo llevó a cabo en Java un investigador holandés llamado E. Dubois en 1891. En ese entonces se le llamó Pitecanthropus (hombremono) erectus y muy pocas personas creyeron en la validez de ese descubrimiento. Se argumentaba que seguramente los restos pertenecieron a un hombre enfermo y con deformaciones. En general los restos de Homo erectus se han encontrado dentro de sedimentos de entre 800 000 y 300 000 años. Los lugares donde se les ha hallado incluyen sobre todo Asia (China), África (Argelia, Tanzania y Sudáfrica) y Europa (Checoslovaquia y Hungría). De éstos sólo en Hungría y en China se han encontrado restos que comprueban que ya usaba el fuego. El tamaño del cráneo de Homo erectus, aunque grande (aproximadamente 1 000 cm3) no es tan grande como el del hombre actual. El uso del fuego le permitió sobrevivir en zonas en las que antes no se podía vivir por las bajas temperaturas.

284

Esto amplió el área de distribución con respecto a la que tenían los australopitécidos o a los Homo habilis. La conciencia de uno mismo El registro fósil vuelve de nuevo a ser muy escaso entre hace 250 y 100 000 años. En ese periodo el Homo erectus desaparece del registro fósil, pero aparece otro Homo en varias zonas de Europa, el cercano Oriente y la Unión Soviética. En Europa se incluyen el valle de Neander, Alemania y varios sitios en Francia. En muchas de ellas se han encontrado restos que evidencian una cultura en donde ¡ya se enterraba a los muertos! Estos tienen una antigüedad de entre 100 y 40 000 años. Eran hombres de una estatura promedio de 1.63 m y tenían una capacidad craneana aproximadamente 15% mayor que la del hombre moderno. Este hombre ha sido llamado Homo neandertalensis o también Homo sapiens neandertalensis. En el primer caso se le considera una especie diferente a la del hombre (Homo sapiens) mientras que en el segundo se le considera sólo una subespecie de éste. Hasta donde sabemos, lo único que lo distingue de aquél es su aparente incapacidad de utilizar símbolos para comunicarse. Un aspecto del ser humano que está ausente en los animales es la conciencia que tenemos de nuestra existencia como individuos. Esto mismo supone que tenemos conciencia de nuestra muerte y de lo que ella implica. Es quizá esto lo que ha generado en la humanidad la presencia de rituales entre los que se incluye el de enterrar a nuestros muertos. ¿El hombre moderno heredero de quién? El hombre de Neandertal seguramente ya tenía una conciencia similar, ya que se han hallado tumbas que incluyen, por ejemplo, hachas, huesos de otros animales, semillas y flores con las que se hacía de los entierros rituales muy particulares. Por ejemplo, de la caverna de Shanidar, en Iraq, de donde se han desenterrado varios restos neandertalensis, se ha podido concluir que además de enterrar a sus muertos ponían flores dentro de las tumbas. Esto se ha descifrado porque se han encontrado granos de polen de varias especies de plantas en grandes cantidades dentro de ellas. Los hombres, entonces, han honrado a sus muertos con flores desde hace aproximadamente 100 000 años. El que el hombre haga rituales mortuorios no solamente se expresa enterrando a sus muertos. Los cadáveres pueden ser colocados en lechos construidos de ramas y hojas en el exterior o incluso cremados. Esto puede haber sucedido pero jamás lo sabremos, puesto que de estas dos costumbres, por razones obvias, no quedan restos en la actualidad.

285

¿HIJOS DE NEANDERTAL? Hay tres teorías acerca de la manera como apareció el hombre moderno y su relación con el hombre de Neandertal. La primera propone que el hombre de Neandertal se extinguió y de otra línea de descendencia dentro del género Homo se originó el Homo sapiens. La segunda sugiere que el hombre de Cro-Magnon (primer fósil con las características del hombre moderno) reemplazó al hombre de Neandertal porque estaba más adaptado al medio ambiente. La tercera, que se considera en la actualidad la más probable, supone que la línea de descendencia del hombre de Neandertal, que era muy diverso (Figura 20), evolucionó transformándolo en lo que ahora es el hombre moderno

EVALUACIÓN

Autoevaluación 1 Preguntas Abiertas 1. Enumere los postulados de la teoría celular 2. ¿Las células pueden moverse por sí mismas? ¿Qué mecanismo utilizan? Pregunta de selección múltiple con única respuesta 3. La ósmosis es un mecanismo de transporte de sustancias a la célula y consiste en el: a. Movimiento de sustancias a través de la membrana, desde la solución de mayor concentración hacia la solución de menor concentración. b. Movimiento de solvente (agua) desde la parte más concentrada hacia la menos concentrada. c. Movimiento de iones y moléculas en contra del gradiente de concentración y con consumo de energía. d. Transporte de líquidos al interior de la célula mediante movimientos citoplasmáticos que engloban estas vesículas de líquido. e. Transporte de partículas sólidas al interior de la célula, a través de movimientos del borde del citoplasma y que engloban las partículas.

286

4. La mitósis como un proceso asexual para la reproducción celular ocurre continuamente. Los principales pasos son interfase, profase, metafase, anafase y telofase. En la etapa de interfase de la división mitótica sucede lo siguiente a. Aparición de cromosomas largos y filamentosos. b. Formación de cromátides c. Duplicación del ácido desoxirribonucleico (ADN) d. Alineamiento de cromosomas en el plano ecuatorial e. Separación de los cromátides de cada cromosoma. Pregunta de selección múltiple con múltiple respuesta En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro Si 1 y 2 son correctas, marque a Si 2 y 3 son correctas, marque b Si 3 y 4 son correctas, marque c Si 2 y 4 son correctas, marque d Si 1 y 3 son correctas, marque e 5. Las células de acuerdo con su grado de complejidad en su organización y por su ubicación dentro de la escala biológica se pueden dividir en: eucarióticas y procarióticas, son características de las células ecuarióticas 1. Presencia de membrana nuclear que delimita el núcleo del citoplasma. 2. Presencia de ADN en una región nuclear diferenciada pero no delimitada por una membrana. 3. Presencia de organelos con morfología y función especializada para cada uno. 4. Ausencia de membranas que separen los organelos entre sí.

Completación

287

6. Las células poseen una estructura altamente organizada, tienen capacidad de autorregulación, de responder ante diferentes estímulos, de respiración, de movimiento, de digestión, de reproducción, de comunicación. Diga cuál es la principal función de cada uno de estos organelos:

Estructura

Función

Ribosoma Núcleo Mitocondria Lisosoma Retículo endoplasmático

Información de retorno autoevaluación1 Autoevaluación 2 Preguntas Abiertas 1. Defina Homeostasis 2. ¿Cuál es la función de los ganglios linfáticos? Pregunta de selección múltiple con única respuesta 3. El conjunto de reacciones químicas que ocurren al interior de las células y que le proporcionan a los seres vivos la materia y energía indispensable para desarrollar sus actividades vitales. Se denomina: a. Osmosis b. Respiración c. Metabolismo d. Anabolismo e. Catabolismo.

288

4. El tejido que permite a la planta realizar la fotosíntesis se denomina: a. Xilema. b. Parénquima c. Meristemático d. Floema e. Colénquima Pregunta de selección múltiple con múltiple respuesta En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro: Si 1 y 2 son correctas, marque a Si 2 y 3 son correctas, marque b Si 3 y 4 son correctas, marque c Si 2 y 4 son correctas, marque d Si 1 y 3 son correctas, marque e 5. Las principales funciones del tejido nervioso son: 1. Servir de sostén al organismo y permitirle el movimiento 2. Detectar, transmitir, analizar y dar respuesta a las variaciones internas y externas. 3. Coordinar el funcionamiento de las funciones del organismo. 4. Transportar y excretar metabolitos 6. Las sales biliares deben su coloración a pigmentos como la bilirrubina. Entre las opciones dadas seleccione dónde son producidas y que función cumplen: 1. Se producen en el hígado 2. Emulsifican las grasas 3. Desdoblan las proteínas 4. Se producen en la vesícula biliar. Completación 7. Los componentes del sistema circulatorio enunciados tiene como función: Estructura Función Capilares Corazón Leucocitos o glóbulos blancos

289

Glóbulos rojos o eritrocitos Plaquetas Información de retorno autoevaluación2 Autoevaluación 3

Preguntas abiertas Desarrolle cuadros de Punnet para resolver los siguientes problemas y explique los resultados de genotipo y fenotipo heredados en la F1. 1. En los gatos el color negro del pelo es dominante frente al color blanco. Si se cruza una gata homocigota recesiva con un gato heterocigoto y tiene una camada de cuatro gatitos: a. ¿Cuál es el genotipo de los padres? b. ¿Cuál es el fenotipo de los padres? c. ¿Cuál es el genotipo de la descendencia en la F1? d. ¿Cuál es el fenotipo de los gatitos y en qué porcentajes? 2. ¿Cuáles son las funciones del ADN? Pregunta de selección múltiple con única respuesta 3. Un individuo es homocigótico para un carácter cuando a) Tiene dos alelos iguales b) Tiene dos alelos diferentes c) Tiene un alelo dominante y uno recesivo d) No tiene alelos para ese carácter información retorno autoevaluación 3 Autoevaluación 4 Preguntas Abiertas 1. Mencione cinco posibles usos de las bacterias. 2. ¿A qué nos referimos cuando hablamos de microorganismos? Pregunta de selección múltiple con única respuesta

290

3. Los diferentes grupos de protozoos se clasifican con base en su a. Habitat. b. Movilidad. c. Reproducción. d. Tamaño.

4. Las bacterias son microorganismos que habitan en el aire, suelo, agua y cuerpo de otros organismos. Las bacterias se caracterizan por a. Ser procarióticas, unicelulares, carentes de pared celular b. Ser eucarióticas, pluricelulares, carentes de pared celular c. Ser procarióticas, unicelulares, con pared celular d. Ser eucarióticas, unicelulares, carentes de pared celular Pregunta de selección múltiple con múltiple respuesta En este tipo de preguntas usted encuentra un enunciado para el cual debe seleccionar dos (2) de las opciones propuestas. Seleccione las respuestas correctas de acuerdo con el siguiente cuadro Si 1 y 2 son correctas, marque a Si 2 y 3 son correctas, marque b Si 3 y 4 son correctas, marque c Si 2 y 4 son correctas, marque d Si 1 y 3 son correctas, marque e

5. Los virus como agentes infecciosos se caracterizan por: 1. Poseer un solo tipo de ácido nucleico 2. Tener el material y mecanismo para su reproducción. 3. Se reproducen en células vivas 1. Tener ARN y ADN conjuntamente. información de retorno autoevaluación 4

291

Autoevaluación 5 Señala si son verdaderas o falsas las siguientes afirmaciones 1. Los productores primarios en el ecosistema son los organismos autotrófos 2. El biotopo es el conjunto de los elementos no vivos que forman parte del ecosistema 3. La mayor parte de la biomasa de la biosfera se concentra en los productores primarios. 4. En el ecosistema los herbívoros son los productores primarios. 5. El factor que suele limitar la productividad del ecosistema es, casi siempre, la energía luminosa disponible. Pregunta de selección múltiple con única respuesta 6. Al estudiar los ecosistemas interesa más el conocimiento de las relaciones entre los elementos, que el cómo son estos elementos. La característica más importante de los ecosistemas es su a. Estabilidad dinámica b. Composición química c. Relación con los individuos d. Fuente de energía e. Equilibrio estático 7. En la naturaleza el problema de desechos se soluciona por la acción de: a. Organismos autótrofos b. Organismos heterótrofos c. Condiciones climáticas d. Descomponedores

8. Entre las especies se pueden establecer relaciones de competencia, aunque en muchas ocasiones, para lograr determinados fines se recurre a compromisos con otras especies que se manifiestan en asociaciones del tipo de una simbiosis. La relación que se establece entre ciertos pájaros que se posan sobre el lomo de vacas y picotean garrapatas, beneficiándose así las aves porque se

292

alimentan; mientras las vacas se liberan de los molestos parásitos, se denomina: a. Parasitismo b. Comensalismo c. Amensalismo d. Mutualismo e. Depredación

9. En los ecosistemas se presentan flujos de energía, ciclos de la materia y relaciones alimentarias. El flujo de energía en el ecosistema es: a. Cíclico y genera organización del sistema b. Lineal y genera organización del sistema c. Cíclico y permite el reciclaje continuo d. Lineal y permite el reciclaje continuo

Preguntas abiertas 10. ¿Cómo se relacionan los factores bióticos y abióticos? 11. ¿Por qué los seres vivos prefieren un habitat y evitan otros? Información de retorno autoevaluación 5 Autoevaluación 6 Preguntas abiertas 1. ¿Por qué es importante la clasificación de los organismos? 2. ¿Cuáles son las 7 categorías principales en el sistema de clasificación? 3. De las siguientes especies identifica las del mismo género: Avena sativa, Canis lupus, Zea maiz, Avena cayuse, Felis domestica, Viola papilonacea, Viola rostrata. 4. Diga en qué especies hay mayor afinidad : entre las especies que pertenecen al mismo filo y distinta clase o entre aquellas que pertenecen al mismo reino y distinto filo Pregunta de selección múltiple con única respuesta

293

5. Según el sistema de clasificación de Whittaker a qué reino pertenecen los organismos con las siguientes características: unicelulares, eucarióticos, su nutrición puede ser en algunos absortiva, ingestiva, en otros fotosintética, pueden ser inmóviles o desplazarse por medio de flagelos, su reproducción se puede realizar por procesos asexuales o por procesos sexuales a) Protista b) Hongos c) Plantas d) Animales e) Mónera

6. Existen muchos métodos de clasificación, según la manera en que evalúan ciertos caracteres. Entre ellos: el tradicional , la fenética, la cladística. En el método cladístico los organismos se agrupan en especies teniendo en cuenta: a) La similitud de carácteres morfológicos y el parentesco filogenético b) Exclusivamente en función de su articulación a grupos monofiléticos. c) El número de carácteres que tienen en común y su cuantificación. d) Los caracteres morfológicos y no morfológicos y la variabilidad. Información de retorno autoevaluación 6

Información de Retorno Autoevaluación 1 Preguntas Abiertas 1. La célula es la unidad básica estructural de todos los seres vivos, todos los organismos están formados por células. La célula es la unidad funcional de todos los organismos. Todo el funcionamiento del organismo depende de las funciones que ocurren al interior de la célula, respiración, reproducción, digestión, crecimiento entre otras. Todas las células se originan por la división de células preexistentes (en otras palabras, a través de la reproducción). Cada célula contiene material genético que se transmite durante este proceso. 2. La célula si puede desplazarse por sí misma mediante: seudópodos, cilios o flagelos.

294

Pregunta de selección múltiple con única respuesta 3) b. 4) c. Pregunta de selección múltiple con múltiple respuesta 5) 1 y 3 = e Completación 6. Estructura Ribosoma

Función Síntesis de proteínas Crecimiento y reproducción celular, almacenamiento y organización de Núcleo los genes, transmisión de la información genética. Producción de energía -ATP- por Mitocondria oxidación de los alimentos o respiración celular Digestión celular (hidrólisis de macromoléculas), destrucción de Lisosoma microorganismos nocivos para la célula, digestión de organelos defectuosos Retículo Transportar materiales dentro de la endoplasmático célula

Información de Retorno Autoevaluación 2 Preguntas Abiertas 1. La Homeostasis es la capacidad de todos los seres vivos de mantener constante las condiciones físicas y químicas de su medio interno. 2. Filtrar la linfa, destruir y eliminar de ella las sustancias tóxicas y los microorganismos infecciosos antes de su circulación por el torrente sanguíneo. Pregunta de selección múltiple con única respuesta

295

3.) c 4.) b Pregunta de selección múltiple con múltiple respuesta 5.) 2 y 3 = b 6.) 1 y 2= a Completación 7.

Estructura

Función

Capilares

Intercambio de gases y nutrientes

Corazón

Bombear toda la sangre hacia el torrente sanguíneo

Leucocitos o glóbulos blancos

Defensa

Glóbulos rojos o eritrocitos

Transporte de oxígeno

Plaquetas

Participar en la coagulación de la sangre

Información de retorno 3 Pregunta abierta a. El genotipo de la gata es nn por ser homocigota recesiva El genotipo del gato es Nn por ser heterocigoto b. El fenotipo de la madre será blanco (para que este se manifieste tiene que ser homocigoto), el fenotipo del padre es negro c. La camada de cuatro gatitos será el resultado Nn x nn N

n

296

n

Nn

nn

n

Nn

nn

Entonces el genotipo de la descendencia es 50% heterocigoto Nn y 50% homocigoto nn d. El fenotipo de la camada es de 50% negros y 50% blancos.

2. Funciones del ADN 

Almacenamiento codificado de la información genética que determina las características futuras de la célula y de los organismos que se desarrollen a partir de dicha información.  Replicación de si mismo o sea elaboración de una copia idéntica del ADN.  Transferencia mediante el ARN (ácido Ribonucleico) de la información genética a las moléculas que realizan la síntesis de proteínas por intermedio de los aminoácidos que son las unidades que forman las proteínas. Selección múltiple con única respuesta a. Cuando tiene dos alelos iguales.

Información de retorno 4 Preguntas abiertas 1. Las bacterias son útiles: 

Para fijar nitrógeno atmosférico que es tomado por las plantas y luego trasferido a los animales.  En la descomposición de materia orgánica muerta ayudando de esta manera a la fertilización del suelo  En la producción de algunos antibióticos  En la producción de determinadas enzimas  En la elaboración de productos lácteos como: queso, yogur , mantequilla  En la producción de vinagre  En la depuración de aguas residuales  En el curtido de cueros  La Echerichia coli ha sido manipulada genéticamente para producir insulina

297

2. Los microorganismos son organismos unicelulares generalmente microscópicos que se dividen en: virus; bacterias; protozoos, algunas algas y hongos. Pregunta de selección múltiple con única respuesta 3.) b. 4.) c. Pregunta de selección múltiple con múltiple respuesta 5.) 1 y 3 = e Información de retorno 5 Preguntas falso o verdadero 1) V 2) F 3) V 4) F 5) V

Pregunta de selección múltiple con única respuesta 6.) a. 7.) d. 8.) d 9.) b.

Preguntas Abiertas 10. Los factores bióticos y abióticos se interrelacionan para constituir un ecosistema, donde cada uno depende del otro, modificándose y transformándose mutuamente a través de la actividad de los seres vivos y las condiciones ambientales para producir un sistema estable en el cual el intercambio de sustancias entre los organismos vivos y los elementos inertes es de tipo circular. 11. Porque cada especie vegetal o animal o microorganismo tienen un requerimiento óptimo para los diversos factores abióticos en el que pueden desarrollar mejor sus funciones, igualmente con los demás seres vivientes tiene

298

interrelaciones que le permiten asegurar su alimentación, territorio, protección, reproducción La distribución geoFigura de una especie puede estar determinada por el grado en el cual sus requerimientos son cumplidos por los factores abióticos presentes. Cada especie tiene: un óptimo, un rango de tolerancia, un límite de tolerancia con respecto a cada factor abiótico. Información de retorno 6 Preguntas abiertas 1. Para poder entender su origen, su evolución y las relaciones de parentesco entre sí. 1. Reino, Filo, Clase, Orden, Familia , Género, Especie. 3. Avena sativa, y Avena cayuse, Viola papilonacea, y Viola rostrata 4. Hay mayor afinidad entre las especies que pertenecen al mismo filo y distinta clase. Pregunta de selección múltiple con única respuesta 5.) a 6.) b

GLOSARIO Glosario Disciplinar Biotipo: Poblaciones con el mismo genotipo. Estructura: En las ciencias biológicas, la estructura se refiere a la organización de los seres vivos como un conjunto de células, organelos, órganos, y sistemas histológico-orgánicos, como soporte físico para la manifestación de las actividades de la vida según la expresión genética heredada.

299

Función: Capacidad de actuar propia de los seres vivos y de sus órganos. Diversidad: abundancia relativa de las especies presentes en regiones biogeoFigura s y en nichos ecológicos específicos. Genética: Parte de la biología que trata de la herencia y de lo relacionado con ella. Estudio científico de cómo se transmiten los caracteres físicos, bioquímicos y de comportamiento de padres a hijos. Evolución: Desarrollo de los organismos, por medio del cual pasan gradualmente de un estado a otro, descendencia con modificaciones, proceso por el que todos los seres vivos de la Tierra han divergido, por descendencia directa, a partir de un origen único que existió hace más de 3.000 millones de años. La palabra evolución tiene cuatro significados que suelen confundirse y deberían mantenerse separados y distintos: 1) el proceso general del cambio en poblaciones y especies, considerado un hecho científico establecido; 2) el «progreso» inevitable desde formas de vida inferiores a otras superiores, un concepto que ha quedado desacreditado; 3) la historia concreta del «arbusto ramificado» de la vida y el origen de grupos diversos o filogenias, interpretado a partir del registro fósil y los estudios bioquímicos, y 4) el mecanismo, o «motor», de la evolución, para el que Darwin y Wallace propusieron la «selección natural», pero que en la actualidad está siendo estudiado y modificado por la investigación de Richard Milner. Interacciones ecológicas de organismos vivos: se refieren a las influencias mutuas, benéficas o perjudiciales que pueden presentarse entre organismos que comparten un mismo nicho ecológico y su impacto sobre el entorno ambiental. Genoma: conjunto de todos los genes de un organismo, de todo el patrimonio genético almacenado en el conjunto de su ADN o de sus cromosomas. Gestión sostenible: Se entiende por gestión sostenible la que permite el crecimiento económico, la elevación de la calidad de vida y el bienestar social sin agotar la base de los recursos naturales renovables en que se sustenta, ni deteriorar el medio ambiente o el derecho de las generaciones futuras a utilizarlo para la satisfacción de sus propias necesidades. Glosario Pedagógico Competencia cognitiva o básica: Hace referencia a la capacidad de identificar conceptos, analizarlos, reconceptualizarlos e incorporarlos a la estructura cognitiva del estudiante.

300

Competencia metacognitiva o compleja: Se relaciona con la capacidad de reflexionar sobre el proceso de construcción conceptual. En otras palabras se refiere a conocer cómo se logra aprender y cómo se pueden cualificar las estrategias y métodos para potenciar el conocimiento. Competencia transversal o paracognitiva: Se refiere a la capacidad de integrar los conocimientos y las experiencias en enfoques alternativos de saberes funcionales para nuevos contextos. Operaciones metacognitivas: Son operaciones mentales de las que el estudiante es consciente, se relacionan con la selección de procedimientos para aprender, permiten la autoevaluación, la autorregulación y la reflexión.

Get in touch

Social

© Copyright 2013 - 2024 MYDOKUMENT.COM - All rights reserved.