Apuntes: trabajando con Nona y Winclada

Apuntes: trabajando con Nona y Winclada E. García-Barros (vers. 2011) Depto. Biología, Univ. Autónoma de Madrid http://www.uam.es/garcia.barros [200
Author:  Ana Valdéz Blanco

0 downloads 86 Views 4MB Size

Story Transcript

Apuntes: trabajando con Nona y Winclada

E. García-Barros (vers. 2011)

Depto. Biología, Univ. Autónoma de Madrid http://www.uam.es/garcia.barros [2006-2011]

Estas diapositivas se usan como demostración básica sin software especializado además de Nona + Winclada, con ayuda de un instructor por lo que no van acompañadas de texto explicativo.

Obtener los programas

Aviso:

nona.exe winclada.exe que estén en la misma carpeta, junto con tu fichero de datos (matriz para analizar)

Tres referencias útiles: General, principios metodología análisis filogenético:

Lipscomb, D., 1998. Basics of cladistic analysis. D. Lipscomb, Department of Biological Sciences, George Washington University, 75 pp.

http://www.gwu.edu/~clade/faculty/lipscomb/Cladistics.pdf Más en detalle sobre Winclada:

Lipscomb, D. Winclada. A windows program for creating, editing, and analyzing systematic data sets. Basic Users Guide.

http://www.gwu.edu/~clade/faculty/lipscomb/Winclad.doc Para manejo y análisis cladístico de secuencias de nucleotidos…

Baldauf, S.L., 2003. Phylogeny for the faint of heart: a tutorial. TRENDS in Genetics, 19(8): 345-351

http://cmbc.ucsd.edu/content/1/docs/Baldauf_345.pdf

Contenido

1- Unos datos para trabajar… diapositiva 6 2- Abrir archivo de datos, preparativos, análisis de parsimonia… diapositiva 12 3- Árbol de consenso… diapositiva 23 4- Información gráfica sobre los cambios en los caracteres… diapositiva 28 5- ¿Como guardar una imagen de este cladograma?... diapositiva 33 6- ¿Puedo modificar el aspecto del cladograma?... diapositiva 36 7- ¿Cómo podría citar estos programas?... diapositiva 37

Ahora pueden ocurrir dos cosas: a)Tengo unos datos preparados, sean binarios o de cualquier otro tipo, categóricos (no numéricos), y puedo designar una de mis “especies” como grupo externo ……. Paso siguiente b) No tengo eso. Entonces visito la página web de Enrique (http://[email protected]), pincho en “docencia”, “laboratorio de taxonomía”, y abajo del todo, puedo descargar un archivo con secuencias de nucleotidos. Me lo guardo en MS-Word, y lo uso para practicar.

Puedo usar mi procesador de textos habitual (Word, Wordpad). Pero me acordaré de: guardar el fichero usando el menú (no voy a darle al iconito del disquete ¡NO!)

Con Word: • acrhivo • guardar como • TEXTO SIN FORMATO pon al archivo un nombre sencillo, de siete letras, sin espacios ni puntos ni tildes ni nada más que letras y números (ejemplo: “fichero”, “matriz1”)

Con Word Pad: • archivo • Documento de texto – formato MS Dos

EGB-2011

• guardar como

xread 'a:pongidos‘ 10 3 Hylobates 0000000000 Pongo 1001001000 Gorilla 1001001010 Pan 1001011001 ; proc/;

xread 'a:pongidos‘ 10 3 Hylobates 0000000000 Pongo 1001001000 Gorilla 1001001010 Pan 1001011001 ; proc/;

EGB-2011

Me valen estos dos formatos.

pon xread esto 'a:pongidos‘ 10 4 Hylobates 0000000000 Pongo 1001001000 Gorilla 1001001010 Pan 1001011001 ; proc/; número de caracteres número de taxones

xread 'a:pongidos‘ 10 4 Hylobates 0000000000 Pongo 1001001000 Gorilla 1001001010 Pan 1001011001 ; proc/;

pon esto otro

EGB-2011

Me valen estos dos formatos.

xread xread 'a:pongidos‘ 'a:pongidos‘ 10 3 10 3 Hylobates 0000000000 Hylobates Pongo 1001001000 0000000000 Gorilla 1001001010 Pongo Pan 1001011001 1001001000 Importante: ; proc/; Gorilla Que tu GRUPO EXTERNO 1001001010 Pan vaya en primer lugar 1001011001 ; proc/;

EGB-2011

Me valen estos dos formatos.

xread 'a:ponpon‘ 361 2

Pongo 10101111010110111111 atgctcgaaccatccgctacccagatcctctcatcaaggtgaacgatactgtgcagattgatttaggg actggcaagataattaactttatcaaatttgatacagcttcaagcagtattggaacagaggcgagccc aacaacgttggggaggaagactgcgcggaatttagtggcaatggctggaatgatgacaaatgtaat cttgccaaattctggatctgcaaaaagtctgcagcctcctgctccagggatgaagaacagtttctttctc cagcccctgccac cccaaacccccctcctgcgtag ; proc/;

EGB-2011

Hylobates 000000000000000----?????????????????????????????????????????????????????????? ???????????????????????????????????????????????????cttcaagc agtattggaacagaggagagcccaacaacgttggggaggaagactgcgcggaatttagtggcaa tggctggaatgatgacaaatgtaatcttgccaaattctggatctgcaaaaagtccgcagcctcctgctc cagggatgaagaacagtttctttctccagcccctgccaccccaaacccccctcctgtgtag

Si Nona y Winclada están en la misma carpeta (junto con tu fichero con la matriz para analizar), simplemente haz doble clik* en el icono de Winclada.exe

expresión “doble clik” sino una onomatopeya mucho más descriptiva de la acción a la que se refiere: “TIKITIKI” (G. San Martín, inéd.)

EGB-2011

*: ciertos expertos opinan que en castellano no debe emplearse la

EGB-2011

Abrir fichero de datos (matriz)

Ver opciones de caracteres

Si tengo caracteres “multiestado” y quiero que sean desordenados: 1

1- selecciono todos los caracteres CHARS - SELECT ALL CHARS, y 2- los hago “no aditivos” Make sel chars NONADDITIVE (fitch)

EGB-2011

2

CHARS - MAKE SEL CHARS NONADDITIVE (fitch)

Todas las demás opciones por defecto

Tree 6 of 6

L= 428

Ci= 63

¿Cuántos árboles obtuve? ¿Uno? ¿Más de uno? ¿Necesitaré un árbol de consenso? Longitud del árbol (número de pasos, número de cambios a lo largo del árbol) Índice de consistencia (apomorfías/nº pasos)

Ri= 60

Índice de retención

Árbol de consenso

En la diapositiva anterior: ¿qué número de árboles se obtuvo? ¿Seeeeeis?

Necesitamos un árbol

de consenso

(Si no es tu caso, puedes pasar a la diapositiva 27)

Los estadísticos son diferentes para este árbol, generalmente su resolución es menor…

Y hay alguna politomía…

Información gráfica sobre los caracteres ¿Dónde hay apomorfías, cuáles son..?

homoplasia no homoplasia

¿Cambios en los caracteres?

¿Número de los caracteres en los que hubo cambios?

¿Estado de los caracteres en cada nudo o / internudo (rama)? Pulsando UNA VEZ

¿Estado anterior y actual de los caracteres? ¿Es decir, de qué estado a cuál otro pasó el carácter en esta rama? Pulsar por segunda vez

¿Cómo guardo una imagen de este cladograma?

Podrías guardarlo como metafichero de Windows. No ocupa espacio y conserva la máxima resolución (puedes insertarlo directamente en archivos de Office)

EGB-2011

EGB-2011

¿Puedo modificar el aspecto gráfico del cladograma?

Prueba el efecto de todos estos botones con símbolos de color gris claro…

¿Cómo podría citar estos programas? Pues por ejemplo:

Nona: Goloboff, P., 1999. NONA (NO NAME), vers. 2. Publicado por el autor. Tucumán, Argentina. [Disponible en http://www.cladistics.com; descargado en febrero-2011].

Winclada:

EGB-2011

Nixon, K.C., 2002. WinClada, vers. 1.00.08. Publicado por el autor. Ithaca, Nueva York. [Disponible en http://www.cladistics.com; descargado en octubre2009].

Get in touch

Social

© Copyright 2013 - 2020 MYDOKUMENT.COM - All rights reserved.